scholarly journals In Silico Processing of the Complete CRISPR-Cas Spacer Space for Identification of PAM Sequences

2018 ◽  
Author(s):  
Brian J Mendoza ◽  
Cong T Trinh
Keyword(s):  
Experimental Studies ◽  
Effector Proteins ◽  
Biological Applications ◽  
Sequence Coverage ◽  
Bacterial Genomes ◽  
Sequence Identity ◽  
Protospacer Adjacent Motif ◽  
Bioinformatic Tool ◽  
Unique Species ◽  
Single Effector

AbstractDespite extensive exploration of the diversity of CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) systems, biological applications have been mostly confined to Class 2 systems, specifically the Cas9 and Cas12 (formerly Cpf1) single effector proteins. A key limitation of exploring and utilizing other CRISPR-Cas systems with unique functionalities, particularly Class I types and their multi-protein effector complex, is the knowledge of the system’s protospacer adjacent motif (PAM) sequence identity. In this work, we developed a systematic pipeline, named CASPERpam, that enables us to comprehensively assess the PAM sequences of all the available CRISPR-Cas systems in the NCBI database of bacterial genomes. The CASPERpam analysis revealed that within the 30,389 assemblies previously screen for CRISPR arrays, there exists 26,364 spacers that match somewhere in the viral, bacterial, and plasmid databases of NCBI, using the constraints of 95% sequence identity and 95% sequence coverage for blast hits. When grouping these results by species, we were able to identify putative PAM sequences for 1,049 among 1,493 unique species. The remaining species either have insufficient data or an undetermined result from the analysis. Finally, we were able to infer certain design principles that are relevant for understanding PAM diversity and a baseline for further experimental studies including PAM assays. We envision CASPERpam is a useful bioinformatic tool for understanding and harnessing the diversity of CRISPR systems.

scholarly journals Modulating Pathogenesis with Mobile-CRISPRi

2019 ◽  
Vol 201 (22) ◽  
Author(s):  
Jiuxin Qu ◽  
Neha K. Prasad ◽  
Michelle A. Yu ◽  
Shuyan Chen ◽  
Amy Lyden ◽  
...  
Keyword(s):  
Gene Expression ◽  
Pathogenic Bacteria ◽  
Bacterial Species ◽  
Effector Proteins ◽  
Infection Model ◽  
Secretion Systems ◽  
Bacterial Genomes ◽  
Gene Encoding ◽  
Content Type ◽  
Animal Infection

ABSTRACT Conditionally essential (CE) genes are required by pathogenic bacteria to establish and maintain infections. CE genes encode virulence factors, such as secretion systems and effector proteins, as well as biosynthetic enzymes that produce metabolites not found in the host environment. Due to their outsized importance in pathogenesis, CE gene products are attractive targets for the next generation of antimicrobials. However, the precise manipulation of CE gene expression in the context of infection is technically challenging, limiting our ability to understand the roles of CE genes in pathogenesis and accordingly design effective inhibitors. We previously developed a suite of CRISPR interference-based gene knockdown tools that are transferred by conjugation and stably integrate into bacterial genomes that we call Mobile-CRISPRi. Here, we show the efficacy of Mobile-CRISPRi in controlling CE gene expression in an animal infection model. We optimize Mobile-CRISPRi in Pseudomonas aeruginosa for use in a murine model of pneumonia by tuning the expression of CRISPRi components to avoid nonspecific toxicity. As a proof of principle, we demonstrate that knock down of a CE gene encoding the type III secretion system (T3SS) activator ExsA blocks effector protein secretion in culture and attenuates virulence in mice. We anticipate that Mobile-CRISPRi will be a valuable tool to probe the function of CE genes across many bacterial species and pathogenesis models. IMPORTANCE Antibiotic resistance is a growing threat to global health. To optimize the use of our existing antibiotics and identify new targets for future inhibitors, understanding the fundamental drivers of bacterial growth in the context of the host immune response is paramount. Historically, these genetic drivers have been difficult to manipulate precisely, as they are requisite for pathogen survival. Here, we provide the first application of Mobile-CRISPRi to study conditionally essential virulence genes in mouse models of lung infection through partial gene perturbation. We envision the use of Mobile-CRISPRi in future pathogenesis models and antibiotic target discovery efforts.

scholarly journals ARG-ANNOT, a New Bioinformatic Tool To Discover Antibiotic Resistance Genes in Bacterial Genomes

2013 ◽  
Vol 58 (1) ◽  
pp. 212-220 ◽  
Author(s):  
Sushim Kumar Gupta ◽  
Babu Roshan Padmanabhan ◽  
Seydina M. Diene ◽  
Rafael Lopez-Rojas ◽  
Marie Kempf ◽  
...  
Keyword(s):  
Antibiotic Resistance ◽  
Resistance Genes ◽  
Gene Sequence ◽  
Antibiotic Resistance Gene ◽  
Antibiotic Resistance Genes ◽  
Genetic Determinants ◽  
Bacterial Genomes ◽  
Content Type ◽  
A Genome ◽  
Bioinformatic Tool

ABSTRACTARG-ANNOT (Antibiotic Resistance Gene-ANNOTation) is a new bioinformatic tool that was created to detect existing and putative new antibiotic resistance (AR) genes in bacterial genomes. ARG-ANNOT uses a local BLAST program in Bio-Edit software that allows the user to analyze sequences without a Web interface. All AR genetic determinants were collected from published works and online resources; nucleotide and protein sequences were retrieved from the NCBI GenBank database. After building a database that includes 1,689 antibiotic resistance genes, the software was tested in a blind manner using 100 random sequences selected from the database to verify that the sensitivity and specificity were at 100% even when partial sequences were queried. Notably, BLAST analysis results obtained using thermtFgene sequence (a new aminoglycoside-modifying enzyme gene sequence that is not included in the database) as a query revealed that the tool was able to link this sequence to short sequences (17 to 40 bp) found in other genes of thermtfamily with significant E values. Finally, the analysis of 178Acinetobacter baumanniiand 20Staphylococcus aureusgenomes allowed the detection of a significantly higher number of AR genes than the Resfinder gene analyzer and 11 point mutations in target genes known to be associated with AR. The average time for the analysis of a genome was 3.35 ± 0.13 min. We have created a concise database for BLAST using a Bio-Edit interface that can detect AR genetic determinants in bacterial genomes and can rapidly and easily discover putative new AR genetic determinants.

scholarly journals An atypical CRISPR-Cas locus in Symbiobacterium thermophilum flanked by a transposase, a reverse transcriptase, the endonuclease MutS2 and a putative Cas9-like protein

2018 ◽  
Author(s):  
Sandeep Chakraborty
Keyword(s):  
Nucleic Acid ◽  
Reverse Transcriptase ◽  
Streptococcus Pyogenes ◽  
Search Algorithm ◽  
Effector Proteins ◽  
Defense System ◽  
Bacterial Genomes ◽  
Uncharacterized Protein ◽  
Crispr Locus ◽  
Cas Proteins

AbstractClustered regularly interspaced short palindromic repeats (CRISPR) is a prokaryotic adaptive defense system that assimilates short sequences of invading genomes (spacers) within repeats, and uses nearby effector proteins (Cas), one of which is an endonuclease (Cas9), to cleave homologous nucleic acid during future infections from the same or closely related organisms. Here, a novel CRISPR locus with uncharacterized Cas proteins, is reported in Symbiobacterium thermophilum (Accid:NC 006177.1) around loc.1248561. Credence to this assertion is provided by four arguments. First, the presence of an exact repeat (CACGTGGGGTTCGGGTCGGACTG, 23 nucleotides) occurs eight times encompassing fragments about 83 nucleotides long. Second, comparison to a known CRISPR-Cas locus in the same organism (loc.355482) with an endonuclease Cas3 (WP 011194444.1, 729 aa) ∼10000 nt upstream shows the presence of a known MutS2 endonuclease (WP 011195247.1, 801 aa) in approximately the same distance in loc.1248561. Thirdly, and remarkably, an uncharacterized protein (1357 aa) long is uncannily close in length to known Cas9 proteins (1368 for Streptococcus pyogenes). Lastly, the presence of transposases and reverse transcriptase (RT) downstream of the repeat indicates this is one of an enigmatic RT-CRISPR locus, Also, the MutS2 endonuclease is not characterized as a CRISPR-endonuclease to the best of my knowledge. Interestingly, this locus was not among the four loci (three confirmed, one probable) reported by crisperfinder (http://crispr.i2bc.paris-saclay.fr/Server), indicating that the search algorithm needs to be revisited. This finding begs the question ‐ how many such CRISPR-Cas loci and Cas9-like proteins lie undiscovered within bacterial genomes?

scholarly journals Hybrid sequence-structure based HMM models leverage the identification of homologous proteins: the example of class II fusion proteins

2018 ◽  
Author(s):  
R. Tetley ◽  
P. Guardado-Calvo ◽  
J. Fedry ◽  
F. Rey ◽  
F. Cazals
Keyword(s):  
Fusion Proteins ◽  
General Setting ◽  
Class Ii ◽  
Pfam Family ◽  
Sequence Structure ◽  
Homologous Proteins ◽  
Structural Motifs ◽  
Sequence Identity ◽  
Structural Conservation ◽  
Unique Species

AbstractWe present a sequence-structure based method characterizing a set of functionally related proteins exhibiting low sequence identity and loose structural conservation. Given a (small) set of structures, our method consists of three main steps. First, pairwise structural alignments are combined with multi-scale geometric analysis to produce structural motifs i.e. regions structurally more conserved than the whole structures. Second, the sub-sequences of the motifs are used to build profile hidden Markov models (HMM) biased towards the structurally conserved regions. Third, these HMM are used to retrieve from UniProtKB proteins harboring signatures compatible with the function studied, in a bootstrap fashion.We apply these hybrid HMM to investigate two questions related to class II fusion proteins, an especially challenging class since known structures exhibit low sequence identity (less than 15%) and loose structural similarity (of the order of 15Å in lRMSD). In a first step, we compare the performances of our hybrid HMM against those of sequence based HMM. Using various learning sets, we show that both classes of HMM retrieve unique species. The number of unique species reported by both classes of methods are comparable, stressing the novelty brought by our hybrid models. In a second step, we use our models to identify 17 plausible HAP2-GSC1 candidate sequences in 10 different drosophila melanogaster species. These models are not identified by the PFÅM family HAP2-GCS1 (PF10699), stressing the ability of our structural motifs to capture signals more subtle than whole Pfam domains.In a more general setting, our method should be of interest for all cases functional families with low sequence identity and loose structural conservation.Our software tools are available from the FunChaT package of the Structural Bioinformatics Library (http://sbl.inria.fr).

scholarly journals Analysis of Vibrio cholerae genomes using a novel bioinformatic tool identifies new, active Type VI Secretion System gene clusters

2019 ◽  
Author(s):  
Cristian V. Crisan ◽  
Aroon T. Chande ◽  
Kenneth Williams ◽  
Vishnu Raghuram ◽  
Lavanya Rishishwar ◽  
...  
Keyword(s):  
Vibrio Cholerae ◽  
Bacterial Species ◽  
Gene Clusters ◽  
Secretion System ◽  
Effector Proteins ◽  
Type Vi Secretion System ◽  
Type Vi Secretion ◽  
Bioinformatic Tool ◽  
Immunity Factor ◽  
Auxiliary Gene

AbstractBackgroundLike many bacteria, Vibrio cholerae, which causes fatal cholera, deploys a harpoon-like Type VI Secretion System (T6SS) to compete against other microbes in environmental and host settings. The T6SS punctures adjacent cells and delivers toxic effector proteins that are harmless to bacteria carrying cognate immunity factors. Only four effector/immunity pairs encoded on one large and three auxiliary gene clusters have been characterized from largely clonal, patient-derived strains of V. cholerae.ResultsWe sequenced two dozen V. cholerae strain genomes from diverse sources and developed a novel and adaptable bioinformatic tool based on Hidden Markov Models. We identified two new T6SS auxiliary gene clusters; one, Aux 5, is described here. Four Aux 5 loci are present in the host strain, each with an atypical effector/immunity gene organization. Structural prediction of the putative effector indicated it is a lipase, which we name TleV1 (Type VI lipase effector Vibrio, TleV1). Ectopic TleV1 expression induced toxicity in E. coli, which was rescued by co-expression of the TleV1 immunity factor. A clinical V. cholerae reference strain expressing the Aux 5 cluster used TleV1 to lyse its parental strain upon contact via its T6SS but was unable to kill parental cells expressing TleV1’s immunity factor.ConclusionWe developed a novel bioinformatic method and identified new T6SS gene clusters in V. cholerae. We also showed the TleV1 toxin is delivered in a T6SS-manner by V. cholerae and can lyse other bacterial cells. Our web-based tool may be modified to identify additional novel T6SS genomic loci in diverse bacterial species.

scholarly journals Massive analysis of 64’628 bacterial genomes to decipher a water reservoir and origin of mobile colistin resistance (mcr) gene variants: is there another role for this family of enzymes?

2019 ◽  
Author(s):  
Mariem Ben Khedher ◽  
Sophie Alexandra Baron ◽  
Toilhata Riziki ◽  
Raymond Ruimy ◽  
Seydina M. Diene ◽  
...  
Keyword(s):  
Resistance Mechanism ◽  
Water Reservoir ◽  
Bioinformatic Analysis ◽  
Gene Variants ◽  
Defense System ◽  
Colistin Resistance ◽  
Sequence Coverage ◽  
Bacterial Genomes ◽  
Natural Antimicrobial ◽  
Ubiquitous Presence

AbstractSince 2015, new worrying colistin resistance mechanism, mediated by mcr-1 gene has been reported worldwide along with eight newly described variants (mcr-2 to mcr-9) but their source(s) and reservoir(s) remain largely unexplored. Here, we conducted a massive bioinformatic analysis of 64’628 downloaded bacterial genomes to investigate the reservoir and origin of these mcr variants. We identified a total of 6’651 significant positive hits (aa sequence coverage > 90 % and similarity >50%) with the nine MCR variants from these genomes that include 39 bacterial genera and more than 1050 species. Although these variants could be identified in bacteria from human and animal sources, we found plenty MCR variants in unsuspected bacteria from environmental origin, especially from water sources. The ubiquitous presence of mcr variants in bacteria from water likely suggests another role in the biosphere of these enzymes as an unknown defense system against natural antimicrobial peptides and/or bacteriophage predation.

scholarly journals Expanding the CRISPR Toolbox with ErCas12a in Zebrafish and Human Cells

2019 ◽  
Author(s):  
Wesley A. Wierson ◽  
Brandon W. Simone ◽  
Zachary WareJoncas ◽  
Carla Mann ◽  
Jordan M. Welker ◽  
...  
Keyword(s):  
Genome Engineering ◽  
Human Cells ◽  
Effector Proteins ◽  
Dna Double Strand Breaks ◽  
Reporter System ◽  
Fluorescent Reporter ◽  
Strand Breaks ◽  
Guide Rnas ◽  
Protospacer Adjacent Motif ◽  
Strand Annealing

AbstractClustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CRISPR associated (Cas) effector proteins enable the targeting of DNA double-strand breaks (DSBs) to defined loci based on a variable length RNA guide specific to each effector. The guide RNAs are generally similar in size and form, consisting of a ~20 nucleotide sequence complementary to the DNA target and an RNA secondary structure recognized by the effector. However, the effector proteins vary in Protospacer Adjacent Motif (PAM) requirements, nuclease activities, and DNA binding kinetics. Recently, ErCas12a, a new member of the Cas12a family, was identified in Eubacterium rectale. Here, we report the first characterization of ErCas12a activity in zebrafish and human cells. Using a fluorescent reporter system, we show that CRISPR/ErCas12a elicits strand annealing mediated DNA repair more efficiently than CRISPR/Cas9. Further, using our previously reported gene targeting method that utilizes short homology, GeneWeld, we demonstrate the use of CRISPR/ErCas12a to integrate reporter alleles into the genomes of both zebrafish and human cells. Together, this work provides methods for deploying an additional CRISPR/Cas system, thus increasing the flexibility researchers have in applying genome engineering technologies.

scholarly journals Functional Genotyping of Sulfurospirillum spp. in Mixed Cultures Allowed the Identification of a New Tetrachloroethene Reductive Dehalogenase

2013 ◽  
Vol 79 (22) ◽  
pp. 6941-6947 ◽  
Author(s):  
Géraldine F. Buttet ◽  
Christof Holliger ◽  
Julien Maillard
Keyword(s):  
Anaerobic Respiration ◽  
Bacterial Genomes ◽  
Content Type ◽  
Reductive Dehalogenase ◽  
Bacterial Consortia ◽  
Sequence Identity ◽  
Reductive Dehalogenase Genes ◽  
High Level ◽  
Substrate Prediction ◽  
Groundwater Pollutant

ABSTRACTReductive dehalogenases are the key enzymes involved in the anaerobic respiration of organohalides such as the widespread groundwater pollutant tetrachloroethene. The increasing number of available bacterial genomes and metagenomes gives access to hundreds of new putative reductive dehalogenase genes that display a high level of sequence diversity and for which substrate prediction remains very challenging. In this study, we present the development of a functional genotyping method targeting the diverse reductive dehalogenases present inSulfurospirillumspp., which allowed us to unambiguously identify a new reductive dehalogenase from our tetrachloroethene-dechlorinating SL2 bacterial consortia. The new enzyme, named PceATCE, shows 92% sequence identity with the well-characterized PceA enzyme ofSulfurospirillum multivorans, but in contrast to the latter, it is restricted to tetrachloroethene as a substrate. Its apparent higher dechlorinating activity with tetrachloroethene likely allowed its selection and maintenance in the bacterial consortia among other enzymes showing broader substrate ranges. The sequence-substrate relationships within tetrachloroethene reductive dehalogenases are also discussed.

How SIMS microscopy can be used in medicine

1992 ◽  
Vol 50 (2) ◽  
pp. 1602-1603
Author(s):  
Philippe Fragu
Keyword(s):  
Mass Spectrometry ◽  
Biomedical Applications ◽  
Secondary Ion Mass Spectrometry ◽  
Chemical Elements ◽  
Biological Applications ◽  
The Past ◽  
Potential Source ◽  
Secondary Ion ◽  
Chemical Integrity ◽  
Scientific Endeavour

The identification, localization and quantification of intracellular chemical elements is an area of scientific endeavour which has not ceased to develop over the past 30 years. Secondary Ion Mass Spectrometry (SIMS) microscopy is widely used for elemental localization problems in geochemistry, metallurgy and electronics. Although the first commercial instruments were available in 1968, biological applications have been gradual as investigators have systematically examined the potential source of artefacts inherent in the method and sought to develop strategies for the analysis of soft biological material with a lateral resolution equivalent to that of the light microscope. In 1992, the prospects offered by this technique are even more encouraging as prototypes of new ion probes appear capable of achieving the ultimate goal, namely the quantitative analysis of micron and submicron regions. The purpose of this review is to underline the requirements for biomedical applications of SIMS microscopy.Sample preparation methodology should preserve both the structural and the chemical integrity of the tissue.

Sign in / Sign up

Export Citation Format

Share Document