scholarly journals An atypical CRISPR-Cas locus in Symbiobacterium thermophilum flanked by a transposase, a reverse transcriptase, the endonuclease MutS2 and a putative Cas9-like protein

2018 ◽  
Author(s):  
Sandeep Chakraborty
Keyword(s):  
Nucleic Acid ◽  
Reverse Transcriptase ◽  
Streptococcus Pyogenes ◽  
Search Algorithm ◽  
Effector Proteins ◽  
Defense System ◽  
Bacterial Genomes ◽  
Uncharacterized Protein ◽  
Crispr Locus ◽  
Cas Proteins

AbstractClustered regularly interspaced short palindromic repeats (CRISPR) is a prokaryotic adaptive defense system that assimilates short sequences of invading genomes (spacers) within repeats, and uses nearby effector proteins (Cas), one of which is an endonuclease (Cas9), to cleave homologous nucleic acid during future infections from the same or closely related organisms. Here, a novel CRISPR locus with uncharacterized Cas proteins, is reported in Symbiobacterium thermophilum (Accid:NC 006177.1) around loc.1248561. Credence to this assertion is provided by four arguments. First, the presence of an exact repeat (CACGTGGGGTTCGGGTCGGACTG, 23 nucleotides) occurs eight times encompassing fragments about 83 nucleotides long. Second, comparison to a known CRISPR-Cas locus in the same organism (loc.355482) with an endonuclease Cas3 (WP 011194444.1, 729 aa) ∼10000 nt upstream shows the presence of a known MutS2 endonuclease (WP 011195247.1, 801 aa) in approximately the same distance in loc.1248561. Thirdly, and remarkably, an uncharacterized protein (1357 aa) long is uncannily close in length to known Cas9 proteins (1368 for Streptococcus pyogenes). Lastly, the presence of transposases and reverse transcriptase (RT) downstream of the repeat indicates this is one of an enigmatic RT-CRISPR locus, Also, the MutS2 endonuclease is not characterized as a CRISPR-endonuclease to the best of my knowledge. Interestingly, this locus was not among the four loci (three confirmed, one probable) reported by crisperfinder (http://crispr.i2bc.paris-saclay.fr/Server), indicating that the search algorithm needs to be revisited. This finding begs the question ‐ how many such CRISPR-Cas loci and Cas9-like proteins lie undiscovered within bacterial genomes?

scholarly journals Type I-E CRISPR-Cas system as an immune system in a eukaryote

2018 ◽  
Author(s):  
Devashish Rath ◽  
Lina Amlinger ◽  
Gargi Bindal ◽  
Magnus Lundgren
Keyword(s):  
Nucleic Acid ◽  
Dna Cleavage ◽  
Basic Research ◽  
Type I ◽  
Crispr Locus ◽  
Adaptive Immune ◽  
Research Platform ◽  
Adaptive Immune Systems ◽  
Cas Proteins

AbstractDefense against viruses and other mobile genetic elements (MGEs) is important in many organisms. The CRISPR-Cas systems found in bacteria and archaea constitute adaptive immune systems that acquire the ability to recognize MGEs by introducing nucleic acid samples, spacers, in the CRISPR locus. The CRISPR is transcribed and processed, and the produced CRISPR RNAs guide Cas proteins to degrade matching nucleic acid sequences. No CRISPR-Cas system is found to occur naturally in eukaryotic cells but here we demonstrate interference by type I-E CRISPR-Cas system from Escherichia coli introduced in Saccharomyces cerevisiae. The designed CRISPR arrays are properly expressed and processed in S. cerevisiae. Targeted plasmids display reduced transformation efficiency, indicative of DNA cleavage. Unlike e.g. Cas9-based systems, which can be used to inactivate MGEs in eukaryotes by introducing specific mutations, type I-E systems processively degrade the target. The type I-E system thus allows for defense without knowledge of MGE gene function. The reconstituted CRISPR-Cas system in S. cerevisiae can also function as a basic research platform for testing the role of various factors in the interference process.

scholarly journals CRISPR-Cas System: The Powerful Modulator of Accessory Genomes in Prokaryotes

2021 ◽  
pp. 1-16
Author(s):  
Anca Butiuc-Keul ◽  
Anca Farkas ◽  
Rahela Carpa ◽  
Dumitrana Iordache
Keyword(s):  
Nucleic Acids ◽  
Pathogenic Bacteria ◽  
The Novel ◽  
Defense System ◽  
Guide Rnas ◽  
Crispr Array ◽  
Different Types ◽  
Evolutionary Trajectories ◽  
Novel Coronavirus ◽  
Cas Proteins

Being frequently exposed to foreign nucleic acids, bacteria and archaea have developed an ingenious adaptive defense system, called CRISPR-Cas. The system is composed of the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) array, together with CRISPR (<i>cas</i>)-associated genes. This system consists of a complex machinery that integrates fragments of foreign nucleic acids from viruses and mobile genetic elements (MGEs), into CRISPR arrays. The inserted segments (spacers) are transcribed and then used by cas proteins as guide RNAs for recognition and inactivation of the targets. Different types and families of CRISPR-Cas systems consist of distinct adaptation and effector modules with evolutionary trajectories, partially independent. The origin of the effector modules and the mechanism of spacer integration/deletion is far less clear. A review of the most recent data regarding the structure, ecology, and evolution of CRISPR-Cas systems and their role in the modulation of accessory genomes in prokaryotes is proposed in this article. The CRISPR-Cas system&apos;s impact on the physiology and ecology of prokaryotes, modulation of horizontal gene transfer events, is also discussed here. This system gained popularity after it was proposed as a tool for plant and animal embryo editing, in cancer therapy, as antimicrobial against pathogenic bacteria, and even for combating the novel coronavirus – SARS-CoV-2; thus, the newest and promising applications are reviewed as well.

HIV-1 Nucleocapsid Traps Reverse Transcriptase on Nucleic Acid Substrates†

Biochemistry ◽  
2008 ◽  
Vol 47 (46) ◽  
pp. 12230-12240 ◽  
Author(s):  
Dina Grohmann ◽  
Julien Godet ◽  
Yves Mély ◽  
Jean-Luc Darlix ◽  
Tobias Restle
Keyword(s):  
Nucleic Acid ◽  
Reverse Transcriptase ◽  
Hiv 1

scholarly journals Modulating Pathogenesis with Mobile-CRISPRi

2019 ◽  
Vol 201 (22) ◽  
Author(s):  
Jiuxin Qu ◽  
Neha K. Prasad ◽  
Michelle A. Yu ◽  
Shuyan Chen ◽  
Amy Lyden ◽  
...  
Keyword(s):  
Gene Expression ◽  
Pathogenic Bacteria ◽  
Bacterial Species ◽  
Effector Proteins ◽  
Infection Model ◽  
Secretion Systems ◽  
Bacterial Genomes ◽  
Gene Encoding ◽  
Content Type ◽  
Animal Infection

ABSTRACT Conditionally essential (CE) genes are required by pathogenic bacteria to establish and maintain infections. CE genes encode virulence factors, such as secretion systems and effector proteins, as well as biosynthetic enzymes that produce metabolites not found in the host environment. Due to their outsized importance in pathogenesis, CE gene products are attractive targets for the next generation of antimicrobials. However, the precise manipulation of CE gene expression in the context of infection is technically challenging, limiting our ability to understand the roles of CE genes in pathogenesis and accordingly design effective inhibitors. We previously developed a suite of CRISPR interference-based gene knockdown tools that are transferred by conjugation and stably integrate into bacterial genomes that we call Mobile-CRISPRi. Here, we show the efficacy of Mobile-CRISPRi in controlling CE gene expression in an animal infection model. We optimize Mobile-CRISPRi in Pseudomonas aeruginosa for use in a murine model of pneumonia by tuning the expression of CRISPRi components to avoid nonspecific toxicity. As a proof of principle, we demonstrate that knock down of a CE gene encoding the type III secretion system (T3SS) activator ExsA blocks effector protein secretion in culture and attenuates virulence in mice. We anticipate that Mobile-CRISPRi will be a valuable tool to probe the function of CE genes across many bacterial species and pathogenesis models. IMPORTANCE Antibiotic resistance is a growing threat to global health. To optimize the use of our existing antibiotics and identify new targets for future inhibitors, understanding the fundamental drivers of bacterial growth in the context of the host immune response is paramount. Historically, these genetic drivers have been difficult to manipulate precisely, as they are requisite for pathogen survival. Here, we provide the first application of Mobile-CRISPRi to study conditionally essential virulence genes in mouse models of lung infection through partial gene perturbation. We envision the use of Mobile-CRISPRi in future pathogenesis models and antibiotic target discovery efforts.

scholarly journals Crucial Role of Nucleic Acid Sensing via Endosomal Toll-Like Receptors for the Defense of Streptococcus pyogenes in vitro and in vivo

2019 ◽  
Vol 10 ◽  
Author(s):  
Anna Hafner ◽  
Ulrike Kolbe ◽  
Isabel Freund ◽  
Virginia Castiglia ◽  
Pavel Kovarik ◽  
...  
Keyword(s):  
Nucleic Acid ◽  
Streptococcus Pyogenes ◽  
Crucial Role ◽  
Toll Like Receptors

scholarly journals Two Coselected Distal Mutations in HIV-1 Reverse Transcriptase (RT) Alter Susceptibility to Nonnucleoside RT Inhibitors and Nucleoside Analogs

2019 ◽  
Vol 93 (11) ◽  
Author(s):  
Paul L. Boyer ◽  
Kevin Melody ◽  
Steven J. Smith ◽  
Linda L. Dunn ◽  
Chris Kline ◽  
...  
Keyword(s):  
Nucleic Acid ◽  
Reverse Transcriptase ◽  
Active Site ◽  
Nucleoside Analogs ◽  
Transcriptase Inhibitor ◽  
Drug Resistant ◽  
Resistance Mutations ◽  
Hydrophobic Region ◽  
Nnrti Resistance ◽  
Hiv 1

ABSTRACTTwo mutations, G112D and M230I, were selected in the reverse transcriptase (RT) of human immunodeficiency virus type 1 (HIV-1) by a novel nonnucleoside reverse transcriptase inhibitor (NNRTI). G112D is located near the HIV-1 polymerase active site; M230I is located near the hydrophobic region where NNRTIs bind. Thus, M230I could directly interfere with NNRTI binding but G112D could not. Biochemical and virological assays were performed to analyze the effects of these mutations individually and in combination. M230I alone caused a reduction in susceptibility to NNRTIs, while G112D alone did not. The G112D/M230I double mutant was less susceptible to NNRTIs than was M230I alone. In contrast, both mutations affected the ability of RT to incorporate nucleoside analogs. We suggest that the mutations interact with each other via the bound nucleic acid substrate; the nucleic acid forms part of the polymerase active site, which is near G112D. The positioning of the nucleic acid is influenced by its interactions with the “primer grip” region and could be influenced by the M230I mutation.IMPORTANCEAlthough antiretroviral therapy (ART) is highly successful, drug-resistant variants can arise that blunt the efficacy of ART. New inhibitors that are broadly effective against known drug-resistant variants are needed, although such compounds might select for novel resistance mutations that affect the sensitivity of the virus to other compounds. Compound 13 selects for resistance mutations that differ from traditional NNRTI resistance mutations. These mutations cause increased sensitivity to NRTIs, such as AZT.

Improvements in the RT-PCR detection of enteric viruses in environmental samples

1998 ◽  
Vol 38 (12) ◽  
pp. 83-86 ◽  
Author(s):  
K. J. Schwab ◽  
F. H. Neill ◽  
M. K. Estes ◽  
R. L. Atmar
Keyword(s):  
Nucleic Acid ◽  
Reverse Transcriptase ◽  
Environmental Samples ◽  
Internal Standard ◽  
Pcr Amplification ◽  
Enteric Viruses ◽  
New Method ◽  
Rt Pcr ◽  
Pcr Product ◽  
Enzyme Method

Current methods for the detection of nucleic acid from enteric viruses in environmental samples usually involve extensive concentration and purification of target viruses followed by RT-PCR amplification using two enzymes, reverse transcriptase and Taq polymerase. We have developed a modified method that improves RT-PCR assays by: (i) the use of an RT-PCR internal standard control RNA to identify potential false negative results caused by inhibition of RT-PCR enzymes; (ii) the use of rTth (Perkin-Elmer, Foster City, CA), a heat-stable enzyme that functions as both a reverse transcriptase and DNA polymerase in a single-tube, single-buffer, elevated-temperature reaction; and (iii) the use of thermolabile uracil N-glycosylase (HK-UNG) (Epicentre Technologies, Madison, WI) to prevent PCR product carryover contamination. The new method was compared to the traditional two-enzyme, RT-PCR method for detection of Norwalk virus (NV) and hepatitis A virus (HAV) in buffer, stool, clam and oyster samples. The new method was at least as sensitive in NV and HAV detection compared to the traditional two-enzyme method. The internal standard control successfully detected inhibitors to RT-PCR amplification. NV and HAV PCR products generated with dUTP replacing dTTP during amplification were seeded into subsequent samples to test the prevention of PCR product carryover contamination by HK-UNG. The new method successfully eliminated PCR product carryover contamination in contrast to the traditional two-enzyme method. These improvements to viral nucleic acid detection have the potential to improve sensitivity, specificity and confidence in RT-PCR results.

scholarly journals Antimicrobial Peptides, Polymorphic Toxins, and Self-Nonself Recognition Systems in Archaea: an Untapped Armory for Intermicrobial Conflicts

mBio ◽  
2019 ◽  
Vol 10 (3) ◽  
Author(s):  
Kira S. Makarova ◽  
Yuri I. Wolf ◽  
Svetlana Karamycheva ◽  
Dapeng Zhang ◽  
L. Aravind ◽  
...  
Keyword(s):  
Antimicrobial Peptides ◽  
Comparative Genomic ◽  
Protein Families ◽  
Bacterial Genomes ◽  
Uncharacterized Protein ◽  
Genomic Locus ◽  
Genomic Analyses ◽  
Nonself Recognition ◽  
Guilt By Association ◽  
Recognition Systems

ABSTRACTNumerous, diverse, highly variable defense and offense genetic systems are encoded in most bacterial genomes and are involved in various forms of conflict among competing microbes or their eukaryotic hosts. Here we focus on the offense and self-versus-nonself discrimination systems encoded by archaeal genomes that so far have remained largely uncharacterized and unannotated. Specifically, we analyze archaeal genomic loci encoding polymorphic and related toxin systems and ribosomally synthesized antimicrobial peptides. Using sensitive methods for sequence comparison and the “guilt by association” approach, we identified such systems in 141 archaeal genomes. These toxins can be classified into four major groups based on the structure of the components involved in the toxin delivery. The toxin domains are often shared between and within each system. We revisit halocin families and substantially expand the halocin C8 family, which was identified in diverse archaeal genomes and also certain bacteria. Finally, we employ features of protein sequences and genomic locus organization characteristic of archaeocins and polymorphic toxins to identify candidates for analogous but not necessarily homologous systems among uncharacterized protein families. This work confidently predicts that more than 1,600 archaeal proteins, currently annotated as “hypothetical” in public databases, are components of conflict and self-versus-nonself discrimination systems.IMPORTANCEDiverse and highly variable systems involved in biological conflicts and self-versus-nonself discrimination are ubiquitous in bacteria but much less studied in archaea. We performed comprehensive comparative genomic analyses of the archaeal systems that share components with analogous bacterial systems and propose an approach to identify new systems that could be involved in these functions. We predict polymorphic toxin systems in 141 archaeal genomes and identify new, archaea-specific toxin and immunity protein families. These systems are widely represented in archaea and are predicted to play major roles in interactions between species and in intermicrobial conflicts. This work is expected to stimulate experimental research to advance the understanding of poorly characterized major aspects of archaeal biology.

Sign in / Sign up

Export Citation Format

Share Document