scholarly journals First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 113-113 ◽  
Author(s):  
H. F. Schwartz ◽  
K. Otto ◽  
H. R. Pappu

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

Plant Disease ◽  
2007 ◽  
Vol 91 (10) ◽  
pp. 1365-1365 ◽  
Author(s):  
C. Córdoba-Sellés ◽  
C. Cebrián-Mico ◽  
A. Alfaro-Fernández ◽  
M. J. Muñoz-Yerbes ◽  
C. Jordá-Gutiérrez

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. The first report of IYSV in Spain was from Albacete in 2003 (1) followed by the Canary Islands in 2005. In November of 2006, disease symptoms suspected to be caused by IYSV were observed on the central and outer leaves of commercial leeks plants (cvs. Asthow, Edison, and Shelton) from Alicante, Spain. Symptoms consisted of dry, white-to-straw-colored, spindle-shaped, irregular chlorotic and necrotic lesions on the leaves. Tissue from symptomatic leaves was sampled and analyzed by a double-antibody sandwich (DAS)-ELISA with specific polyclonal antibodies against Onion yellow dwarf virus (OYDV), Leek yellow stripe virus (LYSV) (Biorad Phyto-Diagnostics, Marnes-La Coquette, France), IYSV, and Tomato spotted wilt virus (TSWV) (Loewe Biochemica, Sauerlach, Germany). Five of seven leek samples belonging to the three cultivars tested were positive for IYSV. All samples were negative for the other viruses tested. The presence of IYSV was verified in the positive samples by reverse transcription (RT)-PCR using primers derived from the nucleocapsid (N) gene of IYSV (1). RT-PCR gave a PCR amplicon of expected size (approximately 790 bp) from symptomatic leek plants. The product of one of the positive leek samples was purified and sequenced (GenBank Accession No. EF427447). Nucleotide sequence analysis confirmed the identity of the amplicon as that of the IYSV N gene. Sequence comparisons showed 99% identity with the sequence of the IYSV Spanish isolate available in GenBank (Accession No. EF419888). Thrips tabaci is the primary vector of IYSV. Although the vector is present in Spain, the efficiency of the Mediterranean ecotype in transmitting the virus is not known. Leek has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, Australia, and the United States (2). To our knowledge, this is the first report of natural infection of leek with IYSV in Spain. References: (1) C. Córdoba-Sellés et al. Plant Dis. 89:1243, 2005. (2) H. F. Schwartz et al. Plant Dis. 91:113, 2007.


Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 327-327 ◽  
Author(s):  
C. A. Hoepting ◽  
H. F. Schwartz ◽  
H. R. Pappu

Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), a potentially devastating disease of onion vectored by onion thrips (Thrips tabaci Lindeman), has been reported from most states in the western United States where significant onion production occurs, with the most recent report from Texas (1). In June 2006, volunteer onion (Allium cepa) plants in Orleans County, New York (Elba muckland) were found to have symptoms indicative of IYSV infection. The scapes (seed stalks) of the volunteer onions found at the edge of a cull pile from a 2005 onion crop exhibited diamond-shaped lesions, each with a distinct green center and a double yellow border. Approximately 25 of 100 plants of red and yellow onion cultivars exhibited characteristic IYSV lesions. The cull pile was composed primarily of locally grown onions, although a few of the bulbs were grown from imported bare-root transplants imported from Arizona. Symptomatic plants tested positive for IYSV using IYSV-specific antiserum from Agdia Inc. (Elkhart, IN) in a double-antibody sandwich-ELISA. The presence of IYSV was verified by reverse transcription (RT)-PCR using primers derived from the small RNA of IYSV (S-RNA). The primers flanked the IYSV nucleocapsid (N) gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′ (3). RT-PCR assays produced a PCR amplicon of expected size (approximately 1.2 kb) and the product was cloned and sequenced. Nucleotide sequence analysis confirmed the identity of the amplicon as that of the IYSV S-RNA. Sequence comparisons showed 95 to 98% identity with known IYSV N gene sequences available in GenBank. The virus is poorly transmitted to onion by mechanical inoculation and we did not have access to a noninfested colony of the onion thrips vector to transfer the virus from these samples to noninfected onions. No asymptomatic plants were tested. Among the onion-growing states in the eastern United States, IYSV has previously only been reported from Georgia (2). To our knowledge, this is the first report of IYSV in New York and the greater northeastern United States. The finding of this disease in New York confirms further spread of the virus within North America and the need for research to develop more effective management options to reduce the impact of IYSV on onion crops. References: (1) M. Miller et al. Plant Dis. 90:1359, 2006. (2) S. W. Mullis et al. Plant Dis. 90:377, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006.


Plant Disease ◽  
2009 ◽  
Vol 93 (8) ◽  
pp. 839-839 ◽  
Author(s):  
S. Bag ◽  
P. Rogers ◽  
R. Watson ◽  
H. R. Pappu

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to onion bulb and seed production in several onion-growing regions of the United States (1,3). While garlic (Allium sativum) was reported to be infected with IYSV in Réunion Island (4), there have been no confirmed reports of natural infection of garlic in the United States. Garlic plants showing near-diamond-shaped lesions were found in August of 2008 in Marion County, Oregon. The 0.4046-ha (1-acre) field plot consisted of various true-seeded garlic varieties and was adjacent to three onion fields that showed IYSV symptoms. Symptoms were observed on 5% of the garlic plants with most of the symptomatic plants displaying small and diffuse straw-colored spots. Seven of these symptomatic plants were selected for testing. Of these, two showed characteristic diamond-shaped, elongated, straw-colored lesions on garlic scapes. However, the lesions were more diffuse with less-defined edges compared with the characteristic diamond-shaped lesions that are often associated with IYSV infection (1). All symptomatic plants were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). To verify IYSV infection, total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV by reverse transcription (RT)-PCR with primers 5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTTAACAAGCAC-3′, which flank the nucleocapsid (N) gene coded by the small RNA of IYSV (2). An approximate 1.1-kb amplicon was obtained from all symptomatic plants and cloned and sequenced. Nucleotide sequence comparisons using BLAST showed that a consensus of three clones derived from the amplicon from garlic (No. FJ514257) was 85 to 99% identical with IYSV sequences available in GenBank (Nos. AF001387, AB180918, and AB286063), confirming the identity of IYSV. To our knowledge, this is the first report of natural infection of IYSV infection of garlic in the United States. Additional surveys and testing are needed to obtain a better understanding of IYSV incidence in garlic to evaluate its impact on garlic production. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.


Plant Disease ◽  
2005 ◽  
Vol 89 (1) ◽  
pp. 105-105 ◽  
Author(s):  
F. J. Crowe ◽  
H. R. Pappu

Iris yellow spot virus (IYSV) of the genus Tospovirus, family Bunyaviridae is considered an emerging or reemerging pathogen affecting onions in the United States. The virus has been endemic to the Treasure Valley of southern Idaho for more than a decade (4). Reports of its further spread came from several states in the region, most recently from New Mexico and Washington (1,3). During the 2004 growing season, a few onion seed crops near Madras (Jefferson County) in central Oregon showed symptoms suggestive of IYSV infection, including characteristic diamond-shaped scape lesions (2). By July, scapes in one-half of a 4-ha field were 100% symptomatic and 95% lodged, leading to nearly total crop failure; in the other half, scapes were 30 to 40% symptomatic and 15% lodged, with symptoms and lodging increasing weekly at 8 weeks before harvest. The half of this crop with greater incidence was immediately adjacent to a field where very limited IYSV-like symptoms were noticed in a 2002–2003 onion seed crop that was harvested in mid-August 2003, after the highly symptomatic 2003–2004 onion seed crop was planted next to it in early July 2003. Both crops were planted from true seed. In another onion seed crop located 1,000 m away, IYSV-like symptoms were abundant around the field edges in July and through the field in August 2004, with approximately 5% lodging by mid-August. A small number of plants with IYSV-like symptoms were present in a few more distant fields, but not in most onion seed fields in central Oregon. Symptomatic plants were collected and tested in the laboratory for confirmation of IYSV infection. IYSV was confirmed using enzyme-linked immunosorbent assay (ELISA) with a commercially available antiserum (Agdia Inc., Elkhart, IN). Total nucleic acids were extracted, and using primers specific to the nucleocapsid (N) gene of IYSV (3), reverse transcription-polymerase chain reaction (RT-PCR) was done. RT-PCR gave DNA amplicons of the expected size. The DNA amplicons were cloned and sequenced. Nucleotide sequence comparisons with known IYSV N gene sequences confirmed virus identity. The rapid spread of IYSV in the Pacific Northwest and its severity of incidence often leading to 100% incidence is a cause for concern for onion growers and industry. Efforts to identify management practices to reduce its impact have to be undertaken on a regional basis because of its widespread occurrence across several states in the northwestern United States. References: (1) R. Creamer et al. Plant Dis. 88:1049, 2004 (2) L. J. du Toit et al. APSnet image of the week. On-line publication: http://apsnet.org/online/archive/ 2003/IW000030.asp , 2003. (3) L. J. du Toit et al. Plant Dis. 88:222, 2004. (4) J. M. Hall et al. Plant Dis. 77:952, 1993.


Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1508-1508 ◽  
Author(s):  
D. M. Sether ◽  
W. B. Borth ◽  
R. S. Shimabuku ◽  
H. R. Pappu ◽  
M. J. Melzer ◽  
...  

Onion (Allium spp.) production in Hawaii is mostly comprised of green onion and the locally prized sweet bulb onions (Allium cepa L.) that include short- and medium-day cultivars. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to bulb and seed onion production in many onion-growing regions of the continental United States and the world (3). In June 2010, straw-colored, diamond-shaped lesions with occasional green islands were observed on leaves of sweet onion ‘Linda Vista’ in an insecticide trial on Maui for onion thrips (Thrips tabaci) control. Collapse and lodging occurred when lesions on leaves were severe. Seven bulbs with green leaves exhibiting lesions were collected from this onion field in the Pulehu Region of the lower Kula District on Maui. Leaf samples that included a lesion or were within 1 cm of a lesion were found to be positive in indirect ELISA with IYSV-specific polyclonal antisera (2). A405nm readings after 1 h ranged from 0.263 to 2.067 for positive samples and 0.055 to 0.073 for healthy onion controls. Four samples that were prepared from leaf tissue several centimeters away from a lesion tested negative in ELISA. Such uneven virus distribution in the plants has been previously reported (4). In July 2010, symptomatic sweet onion from a commercial farm in upper Kula, Maui at the 1,060 to 1,220 m (3,500 to 4,000 foot) elevation tested positive for IYSV by ELISA. Green onion samples collected from a commercial farm in Omaopio, Maui, located approximately 0.8 km (0.5 mile) north of Pulehu, have tested negative, suggesting distribution may be limited at this time. RNA was isolated from leaf tissue from the seven ‘Linda Vista’ sweet onions collected from the Maui insecticide trial. Reverse transcription (RT)-PCR with forward and complementary primers 5′-CTCTTAAACACATTTAACAAGCAC-3′ and 5′-TAAAACAAACATTCAAACAA-3′ flanking the nucleocapsid (N) gene encoded by the small RNA of IYSV was conducted as previously described (1). Amplicons approximately 1.1 kb long were obtained from all seven symptomatic onion samples but not from healthy samples or water controls. Sequencing of selected amplicons confirmed IYSV infection. Three sequence variants (GenBank Accession Nos. HM776014–HM776016) were identified from two RT-PCR reactions. Phylogenetic analyses of the three sequence variants with the neighbor-joining procedure available through NCBI-BLASTn Tree View showed that the highest nucleotide identities of 97 to 98% were shared with IYSV isolates from New Zealand (EU477515), Nevada (FJ713699), and northern California (FJ713700). Phylogenetic analyses with the N-gene showed the sequences from Hawaii are most closely related to isolates from the western United States, Texas, and New Zealand. To date, to our knowledge, IYSV has not been detected on the islands of Kauai, Oahu, Molokai, or Hawaii. The distribution and economic consequences of this disease to Hawaii's onion production are under investigation. References: (1) H. R. Pappu et al. Arch Virol. 151:1015, 2006. (2) H. R. Pappu et al. Plant Dis. 92:588, 2008. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.


Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1066-1066 ◽  
Author(s):  
S. J. Gawande ◽  
A. Khar ◽  
K. E. Lawande

Garlic (Allium sativum) is a spice crop of prime importance in India as well as other parts of the world. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important pathogen of onion bulb and seed crops in many parts of the world (3). The virus is also known to infect garlic and other Allium spp. (2–4). IYSV infection of garlic was reported from Reunion Island (4) and the United States (1). In February 2010, straw-colored, spindle-shaped spots with poorly defined ends were observed on the leaves of a garlic crop at the research farm of the Directorate of Onion and Garlic Research in the Pune District of Maharashtra State, India, 105 days after planting. The spots coalesced to form larger patches on the leaves, suggesting possible IYSV infection. Symptoms were visible on older leaves and more prevalent on cv. G-41, G-282, AC50, AC200, AC283, and Godavari than on other cultivars. The incidence of symptomatic plants was estimated at 5% for G-41 and AC-200, 8% for G-282 and AC283, and 10% for AC50. Leaves were sampled from 40 symptomatic plants per cultivar with each sample composited from young, middle, and older (basal) leaves of the plant. Samples were assayed by double-antibody sandwich-ELISA (Loewe Biochemica GmbH, Sauerlach, Germany) and each tested positive for the virus. Total RNA was extracted from the leaves of ELISA-positive plants using the RNAeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany) and tested by reverse transcription-PCR assay using primers IYSV-F (5′-TCAGAAATCGAGAAACTT-3′) and IYSV-R (5′-TAATTATATCTATCTTTCTTGG-3′) (2) designed to amplify 797 bp of the nucleocapsid (N) gene of IYSV. Amplicons of expected size were obtained and cloned into a pDrive vector (Qiagen GmbH). The recombinant clone was sequenced (GenBank Accession No. HM173691). Sequence comparisons showed 98 to 100% nt identity with other IYSV N gene sequences in GenBank (Nos. EU310294 and EU310286). A phylogenetic analysis of the deduced amino acid sequences of the N gene showed that the garlic isolate of IYSV grouped most closely with onion IYSV isolates from India (GenBank Nos. EU310294, EU310286, EU310300, and EU310296). To our knowledge, this is the first report of natural infection of garlic by IYSV in India. Additional surveys and evaluations are needed to obtain a better understanding of the potential impact of IYSV on garlic production in India. References: (1) S. Bag et al. Plant Dis. 93:839, 2009. (2) A. Bulajic et al. Plant Dis. 93:976, 2009. (3) D. Gent et al. Plant Dis. 90:1468, 2006. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.


Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 377-377 ◽  
Author(s):  
S. W. Mullis ◽  
R. D. Gitaitis ◽  
C. Nischwitz ◽  
A. S. Csinos ◽  
Z. C. Rafael Mallaupoma ◽  
...  

Onions have become an important export crop for Peru during the last few years. The onions produced for export are primarily short-day onions and include Grano- or Granex-type sweet onions. The first of two growing seasons for onion in Peru occurs from February/March until September/October and the second occurs from September/October to December/January. Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), primarily transmitted by onion thrips (Thrips tabaci), has been reported in many countries during recent years, including the United States (1,2). In South America, the virus was reported in Brazil during 1999 (3) and most recently in Chile during 2005 (4). During 2003, an investigation of necrotic lesions and dieback in onions grown near the towns of Supe and Ica, Peru led to the discovery of IYSV in this region. Of 25 samples of symptomatic plants collected from five different fields near Supe, 19 tested strongly positive and an additional three tested weakly positive for IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkhart, IN). None of the samples tested positive for Tomato spotted wilt virus (TSWV). A number of onions with necrosis and dieback symptoms were also observed during 2004 and 2005. During September 2005, 25 plants with symptoms suspected to be caused by IYSV or TSWV in the Supe and Casma valleys were collected and screened for both viruses using DAS-ELISA. All plants screened were positive for IYSV. There was no serological indication of TSWV infection in these samples. The positive samples were blotted onto FTA cards (Whatman Inc., U.K.) to bind the viral RNA for preservation and processed according to the manufacturer's protocols. The presence of IYSV was verified by reverse transcription-polymerase chain reaction (RTPCR) using (5′-TCAGAAATCGAGAAACTT-3′) and (5′-TAATTATATCTATCTTTCTTGG-3′) as forward and reverse primers (1), respectively. The primers amplify the nucleocapsid (N) gene of IYSV, and the RT-PCR products from this reaction were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose to verify the presence of this amplicon in the samples. Subsequent to the September 2005 sampling, 72 additional samples from regions in northern and southern Peru were analyzed in the same manner. The amplicons obtained were cloned, sequenced, and compared with known IYSV isolates for further verification. Onions have become a significant export crop for Peru, and more research is needed to determine the impact of IYSV on the Peruvian onion export crop. To our knowledge, this is the first report of IYSV in onion in Peru. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) L. Pozzer et al. Plant Dis. 83:345, 1999. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.


Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 430-430 ◽  
Author(s):  
V. Trkulja ◽  
J. Mihić Salapura ◽  
D. Kovačić ◽  
I. Stanković ◽  
A. Bulajić ◽  
...  

In July 2012, a survey was conducted to determine the presence of tospoviruses in Bosnia and Herzegovina, symptoms resembling those caused by Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) were observed in an onion (Allium cepa) seed crop in the Gornji Karajzovci locality (Region of Banja Luka). Symptoms included chlorotic to necrotic, straw-colored, spindle- and diamond-shaped lesions, variable in size and randomly distributed on the leaves and particularly on the scapes. Later the lesions enlarged and coalesced, causing scape breakage. Affected plants occurred throughout the field and disease incidence was estimated at 20%. Symptomatic plants were sampled and assayed by double-antibody sandwich (DAS)-ELISA test using commercial polyclonal antisera (Bioreba AG, Reinach, Switzerland) against IYSV and two other tospoviruses, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV). Commercial positive and negative controls were included in each test. IYSV was detected serologically in 19 of 20 screened samples and none of the samples tested positive for TSWV or INSV. The virus was mechanically transmitted from an ELISA-positive sample (302-12) to five of each Petunia × hybrida and Nicotiana benthamiana using chilled 0.01 M phosphate buffer (pH 7) containing 0.1% sodium sulfite (1). All inoculated P. × hybrida showed local necrotic spots, while N. benthamiana developed mild mosaic 4 and 10 days post-inoculation, respectively. However, difficulties were encountered in reproducing the disease symptoms on mechanically inoculated onion plants corroborating a previous study (2). Serological findings were verified with reverse transcription (RT)-PCR. Total RNAs from all naturally infected onion plants as well as mechanically infected N. benthamiana plants were extracted with the RNease Plant Mini Kit (Qiagen, Hilden, Germany). RT-PCR was performed with One-Step RT-PCR Kit (Qiagen) using IYSV-specific primers IYSV56U/IYSV917L (3), designed to amplify an 896-bp fragment of the S RNA which includes whole nucleocapsid (N) gene. Total RNAs from Serbian IYSV isolate from onion (GenBank Accession No. EU586203) and from healthy onion plants were used as positive and negative controls, respectively. An amplicon of the expected size was obtained from each of the plants assayed as well as from positive control, but not from the negative control. The amplified products derived from onion isolate 302-12 was purified (QIAquick PCR Purification Kit, Qiagen), sequenced directly (JX861126), and compared with known IYSV isolates. Sequence analysis of the complete N gene, conducted with MEGA5 software (4), revealed the highest nucleotide identity of 99.5% (100% amino acid identity) with IYSV onion isolate (DQ658242) from Texas. To our knowledge, this is the first report of IYSV in Bosnia and Herzegovina. Onion is an important and traditionally grown vegetable crop in Bosnia and Herzegovina and the presence of IYSV could represent an important constraint to onion and other susceptible host production. The discovery of IYSV on onion should prompt more detailed surveys, thorough inspections and subsequent testing to establish the distribution and incidence of IYSV in Bosnia and Herzegovina. References: (1) A. Kritzman et al. Plant Dis. 85:838, 2001. (2) L. Pozzer et al. Plant Dis. 83:345, 1999. (3) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006. (4) K. Tamura et al. Mol. Biol. Evol. 28:2731, 2011.


Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1070-1070 ◽  
Author(s):  
S. M. K. Widana Gamage ◽  
A. Hassani-Mehraban ◽  
D. Peters

Leek (Allium porrum) has become one of the major leafy vegetable export crops in Sri Lanka during last few years. This year-round crop is cultivated in open fields at elevations between 1,000 and 2,000 m on approximately 1,600 ha with a production of 27,000 t per year (2). In August 2009, straw-colored spots (2 to 3 mm in diameter), surrounded by a greenish halo and a necrotic area, resembling symptoms to those caused by Iris yellow spot virus (IYSV) were observed on leek in Kandapola in the Nuwara Eliya District. Additional thrips damage consisting of silver-colored spots was observed on all plants. IYSV (family Bunyaviridae, genus Tospovirus) was first described and characterized in the Netherlands in 1998 (1). During the last few years, this virus was reported from Australia, Brazil, Chile, France, Germany, Guatemala, India, Israel, New Zealand, Peru, Reunion Island, Serbia, South Africa, Spain, the United States (4), and Japan. Collected samples were initially analyzed for IYSV infections using antisera raised against nucleocapsid (N) protein in a double-antibody sandwich (DAS)-ELISA. The presence of IYSV was confirmed by a reverse transcription (RT)-PCR using IYSV-F-373 (5′CTGCGGGCTTCTCTGG3′) and IYSV-R-779 (5′GACTCACCAATGTCTTCAAC3′) primers that amplify a 400-bp fragment of the N gene. The entire N gene was not obtained when specific primers were used to retrieve the complete N gene. Four nucleotides of the reverse primer GAAAGATAGATATAATTAA (indicated in bold) did not match with sequence at the 3′end of the N gene. Hence, to obtain the remaining parts of the N gene, the primers UHP (5′CACTGGATCCTTTTGTTTTTGTTTTTTG3′) and Asian Termini (5′CCCGGATCCAGAGCAATCGAGGY3′) (3) were combined with IYSV-F and IYSV-R. The obtained amplicons were cloned into pGEM-T easy vector and sequenced. The N gene sequence has been deposited at the NCBI/GenBank (Accession No. GU901211). The deduced N protein sequence(s) were compared with other IYSV N protein sequences available in the GenBank and showed a 92% protein identity with the Brazilian strain (IYSV-BR) and 97% with the Dutch strain (IYSV-NL) with Accession Nos. AAF04199 and AAB61923, respectively. No data on the thrips vector species or on the disease incidence have been collected. The presence of IYSV in Sri Lanka can potentially be considered as a threat for the export of leek. To our knowledge, this is the first report that IYSV occurs in Sri Lanka. References: (1) I. Cortêz et al. Phytopathology 88:1276, 1998. (2) Department of Census and Statistics Sri Lanka. Retrieved from http://www.statistics.gov.lk , 2009. (3) A. Hassani-Mehraban et al. Phytopathology 95:852, 2005. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.


Sign in / Sign up

Export Citation Format

Share Document