scholarly journals First Report of Rice yellow mottle virus in Rice in Uganda

Plant Disease ◽  
2006 ◽  
Vol 90 (5) ◽  
pp. 683-683 ◽  
Author(s):  
A. Pinel-Galzi ◽  
D. Fargette ◽  
R. Hull

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa) is grown (2). During July 2000, plants with leaf yellowing and mottling symptoms were observed in Uganda in a subsistence rice field northeast of Lake Victoria, close to the Nile River. RYMV was detected by using enzyme-linked immunosorbent assay with polyclonal RYMV antisera (1) in the four samples collected. Discriminant monoclonal antibodies revealed that the samples contained RYMV serotype 4, a serotype found in eastern Africa (Madagascar, Kenya, and Tanzania) (2). The 720-nt long coat protein gene of two isolates was amplified by reverse transcriptase-polymerase chain reaction and sequenced (1). The two Ugandan isolates had 99% nt sequence identity (EMBL Accession Nos. AM114523 and AM114524). They belonged to a monophyletic group (97% nt identity) containing isolates from eastern Kenya and northern Tanzania (close to the Lake Victoria). These form a sister group (93% identity) of isolates from Lake Malawi Region in western Tanzania and are more distantly related (88% identity) to the basal strains from eastern Tanzania (2). Isolation of the Lake Victoria Region from the rest of the Tanzania by distance, physical barriers, and patchy rice cultivation explains the specificity of the strain. Year-round growth of wild and cultivated rice around the lake ensures host continuity in time and space that facilitates spread that accounts for the homogeneity of the isolates of this area. Knowledge of the presence of RYMV in Uganda is important since rice cultivation is intensified in this country and is planned in neighboring southern Sudan. References: (1) A. Pinel et al. Arch. Virol. 145:1621, 2000. (2) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1230-1230 ◽  
Author(s):  
I. Ndikumana ◽  
A. Pinel-Galzi ◽  
Z. Negussie ◽  
S. N'chimbi Msolla ◽  
P. Njau ◽  
...  

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.


Plant Disease ◽  
1999 ◽  
Vol 83 (10) ◽  
pp. 931-935 ◽  
Author(s):  
M. N. Ndjiondjop ◽  
L. Albar ◽  
D. Fargette ◽  
C. Fauquet ◽  
A. Ghesquière

Three cultivars of Oryza sativa (IR64, Azucena, and Gigante) and four cultivars of O. glaberrima (Tog5681, Tog5673, CG14, and SG329) were evaluated for their resistance to two isolates of rice yellow mottle virus (RYMV) by enzyme-linked immunosorbent assay (ELISA) and symptomatology. Cultivars Tog5681 and Gigante were highly resistant, and no symptoms were observed when either virus isolate was inoculated at 10 or 20 days postgermination and assayed by ELISA at 7, 14, 22, 35, 50, or 64 days postinoculation. Azucena showed a partial resistance, whereas the other cultivars were susceptible. Symptom appearance was associated with increase in ELISA absorbance in the systemically infected leaves. The best discrimination among the cultivars occurred when the plants were inoculated at 10 days postgermination. Crosses were made between the highly resistant (Gigante and Tog5681) and the susceptible (IR64) cultivars to determine the genetic basis of resistance to RYMV. Evaluation of F1 hybrids and interspecific progenies, as well as the segregation of resistance in F2 and F3 lines of the IR64 × Gigante cross, provided results consistent with the presence of a single recessive resistance gene common to Tog5681 and Gigante.


Plant Disease ◽  
2001 ◽  
Vol 85 (8) ◽  
pp. 920-920 ◽  
Author(s):  
O. Traoré ◽  
A. Pinel ◽  
D. Fargette ◽  
G. Konaté

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is the main virus infecting rice (Oryza sativa) in Africa. First reported in Kenya (East Africa), RYMV was later found in most countries of East and West Africa where rice is grown, and in Madagascar in the Indian Ocean. In Central Africa however, the disease had never been reported in rice fields. Ninety-eight field samples with typical yellow mottle symptoms from cultivated rice and two wild rice species (Oryza longistaminata and O. barthii) were collected in the Soudano-Sahelian zones, in the north of Cameroon and the south of Chad (Central Africa) in September 2000. RYMV was detected by ELISA with polyclonal antisera (1) in all samples. All virus isolates were also mechanically transmitted to rice cv. BG 90-2, which is highly susceptible to RYMV. Tests with monoclonal antibodies showed that most isolates from Central Africa were of the SI serotype, which is widespread in the Soudano-Sahelian zones of West Africa (1). The coat protein gene of 7 isolates was amplified by RT-PCR and the expected 720 bp fragment was obtained. Resulting sequences (AJ306735, AJ317949, AJ317950, AJ317951, AJ317952, AJ317953, AJ317954) shared over 95% sequence identity. They were compared to a set of sequences of RYMV isolates from cultivated rice of different geographical origins (2). Phylogenetic analyses by maximum parsimony (PAUP 4) showed that isolates from Central Africa belonged to a monophyletic group, a sister group of West African isolates from the Soudano-Sahelian zones, further supporting the geographic basis of RYMV diversity (2). RYMV incidence was generally less than 10% but reached 20% in some irrigated plots in the two countries. References: (1) G. Konaté et al. Arch Virol. 142:1117, 1997. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.


2019 ◽  
Vol 8 (30) ◽  
Author(s):  
Mbolarinosy Rakotomalala ◽  
Bayuh Belay Abera ◽  
Jacqueline Rakotoarisoa ◽  
Dawit Alemu ◽  
Eugénie Hébrard ◽  
...  

The full-length genomes of two isolates of Rice yellow mottle virus from Ethiopia were sequenced. A comparison with 28 sequences from East Africa showed that they clustered within a new strain named S4et, related to the S4mg and S4ug strains found in the Lake Victoria Basin and Madagascar, respectively.


2010 ◽  
Vol 121 (1) ◽  
pp. 169-179 ◽  
Author(s):  
Deless Thiémélé ◽  
Arnaud Boisnard ◽  
Marie-Noëlle Ndjiondjop ◽  
Sophie Chéron ◽  
Yacouba Séré ◽  
...  

Plant Disease ◽  
2008 ◽  
Vol 92 (2) ◽  
pp. 316-316 ◽  
Author(s):  
Y. Sere ◽  
F. Sorho ◽  
A. Onasanya ◽  
L. Jobe ◽  
S. Darboe ◽  
...  

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice (Oryza sativa) production in Africa. First reported in Kenya during 1966, RYMV was later found in most countries in Africa where rice is grown (1). In countries in westernmost Africa (The Gambia, Guinea-Bissau, Mauritania, and Senegal), plants with leaf yellowing and mottling symptoms were observed, but RYMV was never isolated. Rice is the staple food in The Gambia. In 2006, four samples were collected from local rice varieties in the Kuntaur Region in the center of The Gambia. Mechanical inoculation with leaf extracts from all samples caused typical yellow mottle symptoms on the susceptible rice varieties BG90-2, Bouaké 189, and IR64. RYMV was detected in the four samples collected by ELISA with polyclonal antisera (2). The 720-nt coat protein gene was amplified for each isolate by reverse-transcriptase-PCR with primers 5′-CAAAGATGGCCAGGAA-3′ (sense) and 5′-CTCCCCCACCCATCCCGAGAATT-3′ (antisense) (2). The RT-PCR products were directly sequenced (EMBL Accession Nos. AM765810, AM765811, AM765812, and AM765813) and then aligned using ClustalW with a pool of RYMV coat protein sequences from West African isolates (EMBL Accession Nos. AJ279905, AJ279901, AJ885137, AJ885124, and AJ279935). Phylogenetic reconstruction by maximum-likelihood with PAUP indicated that the isolates from The Gambia formed a monophyletic group with over 97% nucleotide identity and are closely related to isolates of other countries in West Africa (Burkina Faso, Côte d'Ivoire, Guinea, Mali, and Sierra-Leone) with 91 to 94% identity. Detection of RYMV in The Gambia indicates that RYMV is present in westernmost Africa, which is referred to as the ‘rice belt’ of Africa, and shows that RYMV is widely distributed from eastern Africa (Tanzania) to the western part of the continent. References: (1) N. K. Kouassi et al. Plant Dis. 89:124, 2005. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.


2010 ◽  
Vol 61 (3) ◽  
pp. 371-382 ◽  
Author(s):  
Séverine Lacombe ◽  
Martine Bangratz ◽  
Florence Vignols ◽  
Christophe Brugidou

Sign in / Sign up

Export Citation Format

Share Document