High resistance to rice yellow mottle virus in two cultivated rice cultivars is correlated with failure of cell to cell movement

2001 ◽  
Vol 59 (6) ◽  
pp. 309-316 ◽  
Author(s):  
M.N. Ndjiondjop ◽  
C. Brugidou ◽  
S. Zang ◽  
D. Fargette ◽  
A. Ghesquiere ◽  
...  
Keyword(s):  
High Resistance ◽  
Cell Movement ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Rice Cultivars ◽  
Cultivated Rice ◽  
Yellow Mottle

scholarly journals The Genetic Basis of High Resistance to Rice Yellow Mottle Virus (RYMV) in Cultivars of Two Cultivated Rice Species

Plant Disease ◽  
1999 ◽  
Vol 83 (10) ◽  
pp. 931-935 ◽  
Author(s):  
M. N. Ndjiondjop ◽  
L. Albar ◽  
D. Fargette ◽  
C. Fauquet ◽  
A. Ghesquière
Keyword(s):  
Genetic Basis ◽  
Virus Isolate ◽  
Mottle Virus ◽  
F1 Hybrids ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rice Yellow Mottle Virus ◽  
Recessive Resistance ◽  
Cultivated Rice ◽  
Recessive Resistance Gene ◽  
Yellow Mottle

Three cultivars of Oryza sativa (IR64, Azucena, and Gigante) and four cultivars of O. glaberrima (Tog5681, Tog5673, CG14, and SG329) were evaluated for their resistance to two isolates of rice yellow mottle virus (RYMV) by enzyme-linked immunosorbent assay (ELISA) and symptomatology. Cultivars Tog5681 and Gigante were highly resistant, and no symptoms were observed when either virus isolate was inoculated at 10 or 20 days postgermination and assayed by ELISA at 7, 14, 22, 35, 50, or 64 days postinoculation. Azucena showed a partial resistance, whereas the other cultivars were susceptible. Symptom appearance was associated with increase in ELISA absorbance in the systemically infected leaves. The best discrimination among the cultivars occurred when the plants were inoculated at 10 days postgermination. Crosses were made between the highly resistant (Gigante and Tog5681) and the susceptible (IR64) cultivars to determine the genetic basis of resistance to RYMV. Evaluation of F1 hybrids and interspecific progenies, as well as the segregation of resistance in F2 and F3 lines of the IR64 × Gigante cross, provided results consistent with the presence of a single recessive resistance gene common to Tog5681 and Gigante.

Identification of a second major resistance gene to Rice yellow mottle virus, RYMV2, in the African cultivated rice species, O. glaberrima

2010 ◽  
Vol 121 (1) ◽  
pp. 169-179 ◽  
Author(s):  
Deless Thiémélé ◽  
Arnaud Boisnard ◽  
Marie-Noëlle Ndjiondjop ◽  
Sophie Chéron ◽  
Yacouba Séré ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Cultivated Rice ◽  
Major Resistance Gene ◽  
Yellow Mottle

scholarly journals First Report and Characterization of Rice yellow mottle virus in Central Africa

Plant Disease ◽  
2001 ◽  
Vol 85 (8) ◽  
pp. 920-920 ◽  
Author(s):  
O. Traoré ◽  
A. Pinel ◽  
D. Fargette ◽  
G. Konaté
Keyword(s):  
West Africa ◽  
Phylogenetic Analyses ◽  
Central Africa ◽  
Sister Group ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Cultivated Rice ◽  
Wild Rice Species ◽  
Field Samples ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is the main virus infecting rice (Oryza sativa) in Africa. First reported in Kenya (East Africa), RYMV was later found in most countries of East and West Africa where rice is grown, and in Madagascar in the Indian Ocean. In Central Africa however, the disease had never been reported in rice fields. Ninety-eight field samples with typical yellow mottle symptoms from cultivated rice and two wild rice species (Oryza longistaminata and O. barthii) were collected in the Soudano-Sahelian zones, in the north of Cameroon and the south of Chad (Central Africa) in September 2000. RYMV was detected by ELISA with polyclonal antisera (1) in all samples. All virus isolates were also mechanically transmitted to rice cv. BG 90-2, which is highly susceptible to RYMV. Tests with monoclonal antibodies showed that most isolates from Central Africa were of the SI serotype, which is widespread in the Soudano-Sahelian zones of West Africa (1). The coat protein gene of 7 isolates was amplified by RT-PCR and the expected 720 bp fragment was obtained. Resulting sequences (AJ306735, AJ317949, AJ317950, AJ317951, AJ317952, AJ317953, AJ317954) shared over 95% sequence identity. They were compared to a set of sequences of RYMV isolates from cultivated rice of different geographical origins (2). Phylogenetic analyses by maximum parsimony (PAUP 4) showed that isolates from Central Africa belonged to a monophyletic group, a sister group of West African isolates from the Soudano-Sahelian zones, further supporting the geographic basis of RYMV diversity (2). RYMV incidence was generally less than 10% but reached 20% in some irrigated plots in the two countries. References: (1) G. Konaté et al. Arch Virol. 142:1117, 1997. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000.

scholarly journals Evaluation of rice cultivars for resistance to rice yellow mottle virus

2018 ◽  
Vol 26 (1) ◽  
pp. 49
Author(s):  
H. Kam ◽  
M.-N. Ndjiondjop ◽  
N. Ouedraogo ◽  
M.D. Laing ◽  
A. Ghesquiere
Keyword(s):  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Rice Cultivars ◽  
Yellow Mottle

scholarly journals Relative resistance to Rice yellow mottle virus in rice 

2014 ◽  
Vol 50 (No. 1) ◽  
pp. 1-8 ◽  
Author(s):  
M.T. Salaudeen
Keyword(s):  
Agronomic Traits ◽  
Disease Incidence ◽  
Mottle Virus ◽  
High Yield ◽  
Rice Yellow Mottle Virus ◽  
Rice Cultivars ◽  
Progress Curve ◽  
Breeding Programmes ◽  
Yellow Mottle ◽  
Paddy Yield

We identified sources of Rice yellow mottle virus (RYMV) resistance in rice cultivars. Eight cultivars together with susceptible and resistant controls were evaluated under screenhouse conditions as inoculated and uninoculated treatment in completely randomised design with three replications. Seedlings were inoculated with the virus by sap transmission at two weeks after sowing. Disease incidence and severity (scale 1–9: 1–3 = green leaves with sparse dots or streaks, 9 = yellow or orange leaves and some plant dead), yield, and agronomic traits were recorded. Data analyses included Area Under the Disease Progress Curve (AUDPC), independent t-test, and Analysis of Variance. According to differences in most measured traits control cultivars FARO 29 and Gigante were proved to be the most susceptible and partially tolerant ones, respectively. Cvs FARO 12, FARO 17, FARO 37, and FARO 52 were classified as partially tolerant. Uninoculated control plants performed better than the inoculated for all the yield and agronomic parameters. Reduction in plant height (6%) and number of tillers per plant (4.8%), increased days to heading (3 days), and reduction in paddy yield (6.5%) was lowest in cv. Gigante. Paddy yield per plant of the RYMV-inoculated was the highest in cv. Gigante (2.4 g). The rice cultivars which combined RYMV-resistance with high-yield could be utilised in rice breeding programmes in order to enhance food security.

scholarly journals First Report of Rice yellow mottle virus in Rice in Uganda

Plant Disease ◽  
2006 ◽  
Vol 90 (5) ◽  
pp. 683-683 ◽  
Author(s):  
A. Pinel-Galzi ◽  
D. Fargette ◽  
R. Hull
Keyword(s):  
Lake Victoria ◽  
Sister Group ◽  
Rice Cultivation ◽  
Eastern Africa ◽  
Mottle Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rice Yellow Mottle Virus ◽  
Cultivated Rice ◽  
Northern Tanzania ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV) of the genus Sobemovirus is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa) is grown (2). During July 2000, plants with leaf yellowing and mottling symptoms were observed in Uganda in a subsistence rice field northeast of Lake Victoria, close to the Nile River. RYMV was detected by using enzyme-linked immunosorbent assay with polyclonal RYMV antisera (1) in the four samples collected. Discriminant monoclonal antibodies revealed that the samples contained RYMV serotype 4, a serotype found in eastern Africa (Madagascar, Kenya, and Tanzania) (2). The 720-nt long coat protein gene of two isolates was amplified by reverse transcriptase-polymerase chain reaction and sequenced (1). The two Ugandan isolates had 99% nt sequence identity (EMBL Accession Nos. AM114523 and AM114524). They belonged to a monophyletic group (97% nt identity) containing isolates from eastern Kenya and northern Tanzania (close to the Lake Victoria). These form a sister group (93% identity) of isolates from Lake Malawi Region in western Tanzania and are more distantly related (88% identity) to the basal strains from eastern Tanzania (2). Isolation of the Lake Victoria Region from the rest of the Tanzania by distance, physical barriers, and patchy rice cultivation explains the specificity of the strain. Year-round growth of wild and cultivated rice around the lake ensures host continuity in time and space that facilitates spread that accounts for the homogeneity of the isolates of this area. Knowledge of the presence of RYMV in Uganda is important since rice cultivation is intensified in this country and is planned in neighboring southern Sudan. References: (1) A. Pinel et al. Arch. Virol. 145:1621, 2000. (2) O. Traoré et al. Mol. Ecol. 14:2097, 2005.

scholarly journals Fine genetic mapping of a gene required for Rice yellow mottle virus cell-to-cell movement

2003 ◽  
Vol 107 (2) ◽  
pp. 371-378 ◽  
Author(s):  
L. Albar ◽  
M.-N. Ndjiondjop ◽  
Z. Esshak ◽  
A. Berger ◽  
A. Pinel ◽  
...  
Keyword(s):  
Genetic Mapping ◽  
Cell Movement ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Yellow Mottle ◽  
Fine Genetic Mapping

scholarly journals First Report of Rice yellow mottle virus on Rice in Burundi

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1230-1230 ◽  
Author(s):  
I. Ndikumana ◽  
A. Pinel-Galzi ◽  
Z. Negussie ◽  
S. N'chimbi Msolla ◽  
P. Njau ◽  
...  
Keyword(s):  
Polyclonal Antibodies ◽  
Disease Incidence ◽  
Sandwich Elisa ◽  
Rice Cultivation ◽  
Mottle Virus ◽  
Rice Yellow Mottle Virus ◽  
Cultivated Rice ◽  
Phylogenic Tree ◽  
Northern Tanzania ◽  
Yellow Mottle

Since the mid-1980s, rice cultivation has expanded rapidly in Burundi to reach approximately 50,000 ha in 2011. In 2007, leaf mottling, reduced tillering, and stunting symptoms were observed on rice at Gatumba near Bujumbura, causing small patches in less than 10% of the fields. Rice yellow mottle virus (RYMV, genus Sobemovirus), which has seriously threatened rice cultivation in Africa (1) and was recently described in the neighboring Rwanda (3), was suspected to be involved because of similar symptoms. To identify the pathogen that caused the disease in Burundi, a survey was performed in the major rice-producing regions of Burundi and Rwanda. Six locations in Burundi and four in Rwanda were investigated in April and October 2011. Disease incidence in the fields was estimated to be 15 ± 5%. Symptomatic leaves of 24 cultivated rice plants were collected and tested by double antibody sandwich-ELISA with polyclonal antibodies raised against the RYMV isolate Mg1 (2). All tested samples reacted positively. Four isolates were inoculated on susceptible Oryza sativa cultivar IR64 (2). The typical symptoms of RYMV were reproduced 7 days after inoculation, whereas the noninoculated controls remained healthy. Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from 12 samples. The RYMV coat protein gene was amplified by RT-PCR with primers 5′CGCTCAACATCCTTTTCAGGGTAG3′ and 5′CAAAGATGGCCAGGAA3′ (3). The sequences were deposited in GenBank (Accession Nos. HE654712 to HE654723). To characterize the isolates, the sequences of the tested samples were compared in a phylogenic tree including a set of 45 sequences of isolates from Rwanda, Uganda, western Kenya, and northern Tanzania (2,3). Six isolates from western Burundi, namely Bu1, Bu2, Bu4, Bu7, Bu10, and Bu13 (Accession Nos. HE654712 to HE654716 and HE654718), and the isolate Rw208 (HE654720) from southwestern Rwanda, belonged to strain S4-lm previously reported near Lakes Malawi and Tanganyika. They fell within the group gathering isolates from the western Bugarama plain of Rwanda (3). The isolates Bu16 (HE654719) and Bu17 (HE654717) from Mishiha in eastern Burundi belonged to strain S4-lv previously reported around Lake Victoria. However, they did not cluster with isolates from the eastern and southern provinces of Rwanda. They were genetically more closely related to isolates of strain S4-lv from northern Tanzania. Overall, the phylogeography of RYMV in Burundi and Rwanda region was similar. In the western plain of the two countries, the isolates belonged to the S4-lm lineage, whereas at the east of the two countries at midland altitude, they belonged to the S4-lv lineage. The presence of RYMV in Burundi should be considered in the future integrative pest management strategies for rice cultivation in the country. References: (1) D. Fargette et al. Annu. Rev. Phytopathol. 44:235, 2006. (2) Z. L. Kanyeka et al. Afr. Crop Sci. J. 15:201, 2007. (3) I. Ndikumana et al. New Dis. Rep. 23:18, 2011.

Sign in / Sign up

Export Citation Format

Share Document