scholarly journals Comparison of multiple DNA dyes for real-time PCR: effects of dye concentration and sequence composition on DNA amplification and melting temperature

2007 ◽  
Vol 35 (19) ◽  
pp. e127 ◽  
Author(s):  
Haukur Gudnason ◽  
Martin Dufva ◽  
D.D. Bang ◽  
Anders Wolff
Keyword(s):  
Real Time ◽  
Melting Temperature ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Sequence Composition ◽  
Dna Dyes

scholarly journals Influence of PCR Reagents on DNA Polymerase Extension Rates Measured on Real-Time PCR Instruments

2014 ◽  
Vol 60 (2) ◽  
pp. 334-340 ◽  
Author(s):  
Jesse L Montgomery ◽  
Carl T Wittwer
Keyword(s):  
Real Time ◽  
Melting Temperature ◽  
Dna Polymerase ◽  
Real Time Pcr ◽  
Monovalent Cation ◽  
Polymerase Activity ◽  
Simple Extension ◽  
Extension Rate ◽  
Nucleotide Analogs ◽  
Dna Dyes

Abstract BACKGROUND Radioactive DNA polymerase activity methods are cumbersome and do not provide initial extension rates. A simple extension rate assay would enable study of basic assumptions about PCR and define the limits of rapid PCR. METHODS A continuous assay that monitors DNA polymerase extension using noncovalent DNA dyes on common real-time PCR instruments was developed. Extension rates were measured in nucleotides per second per molecule of polymerase. To initiate the reaction, a nucleotide analog was heat activated at 95 °C for 5 min, the temperature decreased to 75 °C, and fluorescence monitored until substrate exhaustion in 30–90 min. RESULTS The assay was linear with time for over 40% of the reaction and for polymerase concentrations over a 100-fold range (1–100 pmol/L). Extension rates decreased continuously with increasing monovalent cation concentrations (lithium, sodium, potassium, cesium, and ammonium). Melting-temperature depressors had variable effects. DMSO increased rates up to 33%, whereas glycerol had little effect. Betaine, formamide, and 1,2-propanediol decreased rates with increasing concentrations. Four common noncovalent DNA dyes inhibited polymerase extension. Heat-activated nucleotide analogs were 92% activated after 5 min, and hot start DNA polymerases were 73%–90% activated after 20 min. CONCLUSIONS Simple DNA extension rate assays can be performed on real-time PCR instruments. Activity is decreased by monovalent cations, DNA dyes, and most melting temperature depressors. Rational inclusion of PCR components on the basis of their effects on polymerase extension is likely to be useful in PCR, particularly rapid-cycle or fast PCR.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Primers designed for the detection of grapevine pathogens spreading with propagating material by quantitative real-time PCR

2015 ◽  
Vol 21 (1-2) ◽  
Author(s):  
N. Czotter ◽  
E. Manduláné Farkas ◽  
R. Lózsa ◽  
I. Ember ◽  
G. Szûcsné Varga ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Molecular Techniques ◽  
Latent Infections ◽  
Quantitative Real Time Pcr ◽  
Detection And Identification

Several grapevine pathogens are disseminated by propagating material as systemic, but latent infections. Their detection and identification have a basic importance in the production and handling of propagating stocks. Thus several sensitive and reliable diagnostic protocols mostly based on molecular techniques have been developed. Of these methods quantitative real-time PCR (q-PCR) has recently got an emerging importance. Here we collected primer data for the detection and identification of grapevine pathogens which are important in the production of propagating stocks by q-PCR. Additional novel techniques that use DNA amplification, hybridization and  sequencing are also briefly reviewed.

Immunomagnetic Capture of Big Six Shiga Toxin–Producing Escherichia coli Strains in Apple Juice with Detection by Multiplex Real-Time PCR Eliminates Interference from the Food Matrix

2019 ◽  
Vol 82 (9) ◽  
pp. 1512-1523
Author(s):  
ODBERT A. TRIPLETT ◽  
JIEKUN XUAN ◽  
STEVEN FOLEY ◽  
RAJESH NAYAK ◽  
WILLIAM H. TOLLESON
Keyword(s):  
Escherichia Coli ◽  
Real Time ◽  
Internal Control ◽  
Shiga Toxin ◽  
Real Time Pcr ◽  
Apple Juice ◽  
Dna Amplification ◽  
Probability Of Detection ◽  
Solid Agar ◽  
Big Six

ABSTRACT Having reliable methods for detecting Shiga toxin–producing Escherichia coli (STEC) in foods is an important food safety goal. The majority of STEC outbreaks have involved either the O157:H7 serotype or one of six non-O157 serogroups, O26, O45, O103, O111, O121, and O145, termed “The Big Six.” We have compared detection by PCR of the Shiga toxin genes stx1a and stx2a from STEC bacteria isolated from unclarified apple juice by simple centrifugation with the use of an immunocapture technique to minimize contaminants (such as pectin and polyphenols that may copurify with DNA) that may interfere with DNA amplification efficiencies and limit sensitivity. An internal control for successful immunocapture, DNA extraction, and PCR amplification was generated by introducing the pmRaspberry plasmid into an stx null strain, yielding an E. coli O45 pmRaspberry derivative that can be added to food samples directly. Using serial dilutions of a representative Big Six STEC in apple juice, our immunocapture method resulted in a 50% probability of detection value of 3.34, 2.25, and 4.25 CFU for detection by multiplex real-time PCR, growth on solid agar, and multiplex endpoint PCR, respectively. The time to result was 6.5 h, 9.5 h, and 1.5 days for immunocapture of Big Six STECs and detection by multiplex real-time PCR, endpoint PCR, and growth on solid agar, respectively. A set of 52 Big Six STEC isolates and 30 non–Big Six STEC strains was used to establish the inclusivity and exclusivity of the method. Finally, the ability to detect Big Six STEC contamination reliably was confirmed at 4.5 and 45 CFU/25-mL portions of refrigerated apple juice.

Versatility of different melting temperature (Tm) calculator software for robust PCR and real-time PCR oligonucleotide design: A practical guide

Gene Reports ◽  
2016 ◽  
Vol 2 ◽  
pp. 1-3 ◽  
Author(s):  
Mohammad Reza Bakhtiarizadeh ◽  
Mohammad Javad Najaf-Panah ◽  
Hojatollah Mousapour ◽  
Seyed Alireza Salami
Keyword(s):  
Real Time ◽  
Melting Temperature ◽  
Real Time Pcr ◽  
Practical Guide

scholarly journals Real-time PCR for laboratory diagnosis of Acanthamoeba keratitis

2011 ◽  
Vol 32 (2) ◽  
pp. 111
Author(s):  
Joanna Cheng ◽  
Ian Carter ◽  
Liping Wang ◽  
Peter Taylor
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Hot Springs ◽  
Tap Water ◽  
Dna Amplification ◽  
Culture Method ◽  
Laboratory Diagnosis ◽  
Acanthamoeba Keratitis ◽  
Culture Technique ◽  
Human Cornea

Acanthamoeba keratitis is a painful vision-threatening disease of the human cornea. It is characterised by severe ocular pain or partial paracentral stromal ring infiltrate, which can be frequently misdiagnosed as herpes simplex virus keratitis. If the infection is not treated promptly, it may progress to ulceration of the cornea, loss of visual acuity, possibly blindness and even require enucleation. Acanthamoeba sp are found commonly in freshwater, tap water, seawater, hot springs and swimming pools. An epidemiologic case study revealed that major risk factors were the use of contact lenses, predominantly extended-wear soft lenses, the use of homemade rinsing saline and users who wear their lenses while swimming. The conventional method of detecting the formation of oocysts of Acanthamoeba by a culture technique takes an average three?five days. DNA amplification by PCR can improve turnaround time for the diagnosis. A study was carried out in this laboratory to compare the traditional culture method with a real-time PCR assay.

scholarly journals Modified low cost SNP genotyping technique using cycle threshold (Ct) & melting temperature (Tm) values in allele specific real-time PCR

2015 ◽  
Vol 142 (5) ◽  
pp. 555 ◽  
Author(s):  
BVishnu Bhat ◽  
DBenet Bosco Dhas ◽  
AHiasindh Ashmi ◽  
SubashChandra Parija ◽  
N Banupriya
Keyword(s):  
Real Time ◽  
Melting Temperature ◽  
Real Time Pcr ◽  
Low Cost ◽  
Snp Genotyping ◽  
Cycle Threshold ◽  
Allele Specific

scholarly journals Multiple Compact Camera Fluorescence Detector for Real-Time PCR Devices

Sensors ◽  
2021 ◽  
Vol 21 (21) ◽  
pp. 7013
Author(s):  
Seul-Bit-Na Koo ◽  
Hyeon-Gyu Chi ◽  
Jong-Dae Kim ◽  
Yu-Seop Kim ◽  
Ji-Sung Park ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
High Performance ◽  
Signal To Noise Ratio ◽  
Low Cost ◽  
Optical Element ◽  
Dna Amplification ◽  
Biological Research ◽  
Fluorescence Detector ◽  
Fluorescence Excitation

The polymerase chain reaction is an important technique in biological research because it tests for diseases with a small amount of DNA. However, this process is time consuming and can lead to sample contamination. Recently, real-time PCR techniques have emerged which make it possible to monitor the amplification process for each cycle in real time. Existing camera-based systems that measure fluorescence after DNA amplification simultaneously process fluorescence excitation and emission for dozens of tubes. Therefore, there is a limit to the size, cost, and assembly of the optical element. In recent years, imaging devices for high-performance, open platforms have benefitted from significant innovations. In this paper, we propose a fluorescence detector for real-time PCR devices using an open platform camera. This system can reduce the cost, and can be miniaturized. To simplify the optical system, four low-cost, compact cameras were used. In addition, the field of view of the entire tube was minimized by dividing it into quadrants. An effective image processing method was used to compensate for the reduction in the signal-to-noise ratio. Using a reference fluorescence material, it was confirmed that the proposed system enables stable fluorescence detection according to the amount of DNA.

Sign in / Sign up

Export Citation Format

Share Document