scholarly journals Real-time PCR for laboratory diagnosis of Acanthamoeba keratitis

2011 ◽  
Vol 32 (2) ◽  
pp. 111
Author(s):  
Joanna Cheng ◽  
Ian Carter ◽  
Liping Wang ◽  
Peter Taylor
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Hot Springs ◽  
Tap Water ◽  
Dna Amplification ◽  
Culture Method ◽  
Laboratory Diagnosis ◽  
Acanthamoeba Keratitis ◽  
Culture Technique ◽  
Human Cornea

Acanthamoeba keratitis is a painful vision-threatening disease of the human cornea. It is characterised by severe ocular pain or partial paracentral stromal ring infiltrate, which can be frequently misdiagnosed as herpes simplex virus keratitis. If the infection is not treated promptly, it may progress to ulceration of the cornea, loss of visual acuity, possibly blindness and even require enucleation. Acanthamoeba sp are found commonly in freshwater, tap water, seawater, hot springs and swimming pools. An epidemiologic case study revealed that major risk factors were the use of contact lenses, predominantly extended-wear soft lenses, the use of homemade rinsing saline and users who wear their lenses while swimming. The conventional method of detecting the formation of oocysts of Acanthamoeba by a culture technique takes an average three?five days. DNA amplification by PCR can improve turnaround time for the diagnosis. A study was carried out in this laboratory to compare the traditional culture method with a real-time PCR assay.

scholarly journals Validation of Real-Time PCR for Laboratory Diagnosis of Acanthamoeba Keratitis

2008 ◽  
Vol 46 (10) ◽  
pp. 3232-3236 ◽  
Author(s):  
P. P. Thompson ◽  
R. P. Kowalski ◽  
R. M. Q. Shanks ◽  
Y. J. Gordon
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Laboratory Diagnosis ◽  
Acanthamoeba Keratitis

Comparison of a Real-Time PCR Method with a Culture Method for the Detection of Salmonella enterica Serotype Enteritidis in Naturally Contaminated Environmental Samples from Integrated Poultry Houses

2012 ◽  
Vol 75 (4) ◽  
pp. 743-747 ◽  
Author(s):  
BWALYA LUNGU ◽  
W. DOUGLAS WALTMAN ◽  
ROY D. BERGHAUS ◽  
CHARLES L. HOFACRE
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Salmonella Enteritidis ◽  
Culture Method ◽  
Pcr Assay ◽  
Culture Methods ◽  
The Real ◽  
Selective Enrichment ◽  
Conventional Culture ◽  
Field Samples

Conventional culture methods have traditionally been considered the “gold standard” for the isolation and identification of foodborne bacterial pathogens. However, culture methods are labor-intensive and time-consuming. A Salmonella enterica serotype Enteritidis–specific real-time PCR assay that recently received interim approval by the National Poultry Improvement Plan for the detection of Salmonella Enteritidis was evaluated against a culture method that had also received interim National Poultry Improvement Plan approval for the analysis of environmental samples from integrated poultry houses. The method was validated with 422 field samples collected by either the boot sock or drag swab method. The samples were cultured by selective enrichment in tetrathionate broth followed by transfer onto a modified semisolid Rappaport-Vassiliadis medium and then plating onto brilliant green with novobiocin and xylose lysine brilliant Tergitol 4 plates. One-milliliter aliquots of the selective enrichment broths from each sample were collected for DNA extraction by the commercial PrepSEQ nucleic acid extraction assay and analysis by the Salmonella Enteritidis–specific real-time PCR assay. The real-time PCR assay detected no significant differences between the boot sock and drag swab samples. In contrast, the culture method detected a significantly higher number of positive samples from boot socks. The diagnostic sensitivity of the real-time PCR assay for the field samples was significantly higher than that of the culture method. The kappa value obtained was 0.46, indicating moderate agreement between the real-time PCR assay and the culture method. In addition, the real-time PCR method had a turnaround time of 2 days compared with 4 to 8 days for the culture method. The higher sensitivity as well as the reduction in time and labor makes this real-time PCR assay an excellent alternative to conventional culture methods for diagnostic purposes, surveillance, and research studies to improve food safety.

scholarly journals Evaluation of StrepBSelectChromogenic Medium and the Fast-Track Diagnostics Group B Streptococcus (GBS) Real-Time PCR Assay Compared to Routine Culture for Detection of GBS during Antepartum Screening

2017 ◽  
Vol 55 (7) ◽  
pp. 2137-2142 ◽  
Author(s):  
Deirdre L. Church ◽  
Heather Baxter ◽  
Tracie Lloyd ◽  
Oscar Larios ◽  
Daniel B. Gregson
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Fast Track ◽  
Group B Streptococcus ◽  
Culture Method ◽  
Predictive Values ◽  
Content Type ◽  
Standard Culture ◽  
Group B ◽  
The Cost

ABSTRACTLife-threatening infection in neonates due to group BStreptococcus(GBS) is preventable by screening of near-term pregnant women and treatment at delivery. A total of 295 vaginal-rectal swabs were collected from women attending antepartum clinics in Calgary, Alberta, Canada. GBS colonization was detected by the standard culture method (Strep B Carrot Broth subcultured to blood agar with a neomycin disk) and compared to recovery with Strep Group B Broth (Dalynn Biologicals) subcultured to StrepBSelectchromogenic medium (CM; Bio-Rad Laboratories) and the Fast-Track Diagnostics GBS real-time PCR (quantitative PCR [qPCR]) assay (Phoenix Airmid Biomedical Corp.) performed with broth-enriched samples and the Abbottm2000sp/m2000rt system. A total of 62/295 (21%) women were colonized with GBS; 58 (19.7%) cases were detected by standard culture, while CM and qPCR each found 61 (20.7%) cases. The qPCR and CM were similar in performance, with sensitivities, specificities, and positive and negative predictive values of 98.4 and 98.4%, 99.6 and 99.6%, 98.4 and 98.4%, and 99.6 and 99.6%, respectively, compared to routine culture. Both qPCR and CM would allow more rapid reporting of routine GBS screening results than standard culture. Although the cost per test was similar for standard culture and CM, the routine use of qPCR would cost approximately four times as much as culture-based detection. Laboratories worldwide should consider implementing one of the newer methods for primary GBS testing, depending on the cost limitations of different health care jurisdictions.

Molecular Detection of Adenovirus in Tap Water from Coastal Areas Of Karachi Pakistan:The Real-Time PCR Assay

2021 ◽  
Vol 156 (Supplement_1) ◽  
pp. S140-S140
Author(s):  
A Kalam
Keyword(s):  
Nucleic Acid ◽  
Real Time ◽  
Low Income ◽  
Water Samples ◽  
Real Time Pcr ◽  
Tap Water ◽  
Watery Diarrhea ◽  
Acid Extraction ◽  
Pcr Assay ◽  
Viral Contamination

Abstract Introduction/Objective Diarrhea is a major source of morbidity and mortality in low-income and middle-income countries. In underdeveloped countries, diseases caused by viruses identified in environmental samples cause major health problems. Little knowledge about the frequency and pattern of viral contamination of drinking water sources in these resource-poor settings. Adenovirus which causes watery diarrhea, particular has been recognized as important causal pathogen. Adenovirus remains a global threat to public health and an indicator of inequity and lack of social development. Tap water samples from coastal sites in Karachi between 2019 and 2020 over a period of 11 months. The total of 40 tap water sample was examined for infectious Adenovirus by a real time polymerase chain reaction (PCR) amplification. Methods/Case Report This Pilot study is conducted on tap water samples from Karachi Pakistan, n=40 are processed. Extraction of nucleic acid from all filtered water samples collected with Sterivex filter units by using Qiagen DNeasy Power Water Sterivex Kit. As per the manufacturer’s instruction. Phocine herpesvirus(PhHV) is added as an external positive control to monitor the efficiency of nucleic acid extraction and amplification. TaqMan Universal PCR Master Mix (Thermo Fisher Scientific) is being used in probe based real time PCR assay,the below 35 Ct value is considered as a positive sample. Results (if a Case Study enter NA) Results showed the total of 37.7% of the sources were positive for adenovirus.The level of viral contamination was moderate to high. Conclusion The results has been showed that no seasonal pattern for viral contaminations was found after samples obtained during the dry and wet seasons were compared. Further the Real time PCR assay increases the sensitivity and provides the high resolution of pathogen detection.

A Real-Time PCR Assay for the Detection of Salmonella in a Wide Variety of Food and Food-Animal Matrices†

2007 ◽  
Vol 70 (5) ◽  
pp. 1080-1087 ◽  
Author(s):  
V. M. BOHAYCHUK ◽  
G. E. GENSLER ◽  
M. E. McFALL ◽  
R. K. KING ◽  
D. G. RENTER
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Culture Method ◽  
Pcr Assay ◽  
Culture Methods ◽  
The Real ◽  
Conventional Culture ◽  
Food Animal ◽  
Highly Sensitive ◽  
Field Samples

Conventional culture methods have traditionally been considered the “gold standards” for the isolation and identification of foodborne pathogens. However, culture methods are labor-intensive and time-consuming. We have developed a real-time PCR assay for the detection of Salmonella in a variety of food and food-animal matrices. The real-time PCR assay incorporates both primers and hybridization probes based on the sequence of the Salmonella invA gene and uses fluorescent resonance energy transfer technology to ensure highly sensitive and specific results. This method correctly classified 51 laboratory isolates of Salmonella and 28 non-Salmonella strains. The method was also validated with a large number of field samples that consisted of porcine feces and cecal contents, pork carcasses, bovine feces and beef carcasses, poultry cecal contents and carcasses, equine feces, animal feeds, and various food products. The samples (3,388) were preenriched in buffered peptone water and then selectively enriched in tetrathionate and Rappaport-Vassiliadis broths. Aliquots of the selective enrichment broths were combined for DNA extraction and analysis by the real-time PCR assay. When compared with the culture method, the diagnostic sensitivity of the PCR assay for the various matrices ranged from 97.1 to 100.0%, and the diagnostic specificity ranged from 91.3 to 100.0%. Kappa values ranged from 0.87 to 1.00, indicating excellent agreement of the real-time PCR assay to the culture method. The reduction in time and labor makes this highly sensitive and specific real-time PCR assay an excellent alternative to conventional culture methods for surveillance and research studies to improve food safety.

scholarly journals Isolation and molecular characterization of Mycobacterium tuberculosis complex isolated from raw milk in some dairy farms in Egypt

2016 ◽  
Vol 5 (2) ◽  
pp. 105
Author(s):  
Heba Hussien ◽  
Eman Mahrous
Keyword(s):  
Mycobacterium Tuberculosis ◽  
Real Time ◽  
Real Time Pcr ◽  
Culture Method ◽  
Raw Milk ◽  
Accurate Method ◽  
Tuberculosis Complex ◽  
Milk Samples ◽  
Source Of Infection

<p>This study was conducted to detect <em>Mycobacterium tuberculosis</em> complex in milk in three Egyptian Governorates; El-Sharkia, El-Menoufia and El-Behera Governorates. 300 milk samples were collected from tuberculin positive cases, 18 (6.0%) were shedding <em>Mycobacterium tuberculosis</em> complex in their milk which detected by real time PCR. On another hand, 170 milk samples were collected from tuberculin negative cases, 5 (2.9%) were shedding <em>Mycobacterium tuberculosis</em> complex in their milk which detected by real time PCR. All milk samples were examined by three techniques including Microscopic examination, culture and real time PCR. Real time PCR is more rapid and accurate method than microscopic and culture method. The isolated colonies from culture were examined by Multiplex PCR to demonstrate the source of infection either human or animal source.</p>

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

scholarly journals Primers designed for the detection of grapevine pathogens spreading with propagating material by quantitative real-time PCR

2015 ◽  
Vol 21 (1-2) ◽  
Author(s):  
N. Czotter ◽  
E. Manduláné Farkas ◽  
R. Lózsa ◽  
I. Ember ◽  
G. Szûcsné Varga ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Molecular Techniques ◽  
Latent Infections ◽  
Quantitative Real Time Pcr ◽  
Detection And Identification

Several grapevine pathogens are disseminated by propagating material as systemic, but latent infections. Their detection and identification have a basic importance in the production and handling of propagating stocks. Thus several sensitive and reliable diagnostic protocols mostly based on molecular techniques have been developed. Of these methods quantitative real-time PCR (q-PCR) has recently got an emerging importance. Here we collected primer data for the detection and identification of grapevine pathogens which are important in the production of propagating stocks by q-PCR. Additional novel techniques that use DNA amplification, hybridization and  sequencing are also briefly reviewed.

scholarly journals Evaluation of a Sample Pooling Strategy for Sars-cov-2 Using Real Time PCR

2021 ◽  
Author(s):  
Annet M Nankya ◽  
Luke Nyakarahuka ◽  
Stephen Balinandi ◽  
John Kayiwa ◽  
Julius Lutwama ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Virus Disease ◽  
Laboratory Diagnosis ◽  
Turnaround Time ◽  
Limited Resources ◽  
Asymptomatic Patients ◽  
Sample Pooling ◽  
Sample Testing ◽  
Pooling Strategy

Abstract Back ground: Corona Virus Disease 2019 (COVID 19) in Uganda was first reported in a male traveler from Dubai on 21st March, 2020 shortly after WHO had announced the condition as a global pandemic. Timely laboratory diagnosis of COVID -19 for all samples from both symptomatic and asymptomatic patients was observed as key in containing the pandemic and breaking the chain of transmission. However, there was a challenge of limited resources required for testing SARS-COV-2 in low and middle income countries. To mitigate this, a study was conducted to evaluate a sample pooling strategy for COVI-19 using real time PCR. The cost implication and the turn around time of pooled sample testing versus individual sample testing were also compared.Methods: In this study, 1260 randomly selected samples submitted to Uganda Virus Research Institute for analysis were batched in pools of 5, 10, and 15. The pools were then extracted using a Qiagen kit. Both individual and pooled RNA were screened for the SARS-COV-2 E gene using a Berlin kit. Results: Out of 1260 samples tested, 21 pools were positive in pools of 5 samples, 16 were positive in pools of 10 and 14 were positive in pools of 15 samples. The study also revealed that the pooling strategy helps to save a lot on resources, time and expands diagnostic capabilities without affecting the sensitivity of the test in areas with low SARS-COV-2 prevalence.Conclusion: This study demonstrated that the pooling strategy for COVID-19 reduced on the turnaround time and there was a substantial increase in the overall testing capacity with limited resources as compared to individual testing.

Direct detection ofCampylobacter jejuniin human stool samples by real-time PCR

2008 ◽  
Vol 54 (9) ◽  
pp. 742-747 ◽  
Author(s):  
Shiyong Lin ◽  
Xinying Wang ◽  
Haoxuan Zheng ◽  
Zhengguo Mao ◽  
Yong Sun ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Direct Detection ◽  
Culture Method ◽  
Turnaround Time ◽  
Culture Methods ◽  
Time Saving ◽  
Whole Process ◽  
Pure Cultures ◽  
Stool Samples

Our purpose was to establish a quick and accurate real-time PCR (rtPCR) method to detect Campylobacter jejuni directly from human diarrheal stool as an alternative to traditional culture methods. To determine the consistency of rtPCR and culture method, 256 clinical diarrheal stool samples and 50 normal stool samples from healthy individuals were examined, and the whole process was double-blinded. Our data showed that the sensitivity of rtPCR in pure cultures and stool was 102CFU·mL–1and 103CFU·g–1, respectively. Of the 256 diarrheal samples, 10 specimens were successfully detected by both methods, whereas two specimens were PCR positive but culture negative. No positive results were found by these two methods in 50 normal specimens. Our data suggested that rtPCR was convenient in operation and time-saving (turnaround time 3.5–4 h), so it could be used for clinical diagnostic and epidemiological purposes.

Sign in / Sign up

Export Citation Format

Share Document