scholarly journals Preferential binding of a G-quadruplex ligand to human chromosome ends

2005 ◽  
Vol 33 (13) ◽  
pp. 4182-4190 ◽  
Author(s):  
C. Granotier
Keyword(s):  
Human Chromosome ◽  
G Quadruplex ◽  
Preferential Binding

scholarly journals Oxadiazole/Pyridine-Based Ligands: A Structural Tuning for Enhancing G-Quadruplex Binding

Molecules ◽  
2018 ◽  
Vol 23 (9) ◽  
pp. 2162 ◽  
Author(s):  
Filippo Doria ◽  
Valentina Pirota ◽  
Michele Petenzi ◽  
Marie-Paule Teulade-Fichou ◽  
Daniela Verga ◽  
...  
Keyword(s):  
Nucleic Acid ◽  
Structural Transition ◽  
Binding Mode ◽  
Telomeric Sequence ◽  
Recognition Element ◽  
New Family ◽  
G Quadruplex ◽  
Preferential Binding ◽  
High Cytotoxicity ◽  
Nucleic Acid Structures

Non-macrocyclic heteroaryls represent a valuable class of ligands for nucleic acid recognition. In this regard, non-macrocyclic pyridyl polyoxazoles and polyoxadiazoles were recently identified as selective G-quadruplex stabilizing compounds with high cytotoxicity and promising anticancer activity. Herein, we describe the synthesis of a new family of heteroaryls containing oxadiazole and pyridine moieties targeting DNA G-quadruplexes. To perform a structure–activity analysis identifying determinants of activity and selectivity, we followed a convergent synthetic pathway to modulate the nature and number of the heterocycles (1,3-oxazole vs. 1,2,4-oxadiazole and pyridine vs. benzene). Each ligand was evaluated towards secondary nucleic acid structures, which have been chosen as a prototype to mimic cancer-associated G-quadruplex structures (e.g., the human telomeric sequence, c-myc and c-kit promoters). Interestingly, heptapyridyl-oxadiazole compounds showed preferential binding towards the telomeric sequence (22AG) in competitive conditions vs. duplex DNA. In addition, G4-FID assays suggest a different binding mode from the classical stacking on the external G-quartet. Additionally, CD titrations in the presence of the two most promising compounds for affinity, TOxAzaPy and TOxAzaPhen, display a structural transition of 22AG in K-rich buffer. This investigation suggests that the pyridyl-oxadiazole motif is a promising recognition element for G-quadruplexes, combining seven heteroaryls in a single binding unit.

scholarly journals A Fragment-Based Approach for the Development of G-Quadruplex Ligands: Role of the Amidoxime Moiety

Molecules ◽  
2018 ◽  
Vol 23 (8) ◽  
pp. 1874 ◽  
Author(s):  
Martina Tassinari ◽  
Alberto Lena ◽  
Elena Butovskaya ◽  
Valentina Pirota ◽  
Matteo Nadai ◽  
...  
Keyword(s):  
High Throughput Screening ◽  
Viral Gene Expression ◽  
Viral Gene ◽  
Screening Methods ◽  
Lead Compounds ◽  
Immunodeficiency Virus ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Nucleic Acid Structures ◽  
Hiv 1

G-quadruplex (G4) nucleic acid structures have been reported to be involved in several human pathologies, including cancer, neurodegenerative disorders and infectious diseases; however, G4 targeting compounds still need implementation in terms of drug-like properties and selectivity in order to reach the clinical use. So far, G4 ligands have been mainly identified through high-throughput screening methods or design of molecules with pre-set features. Here, we describe the development of new heterocyclic ligands through a fragment-based drug discovery (FBDD) approach. The ligands were designed against the major G4 present in the long terminal repeat (LTR) promoter region of the human immunodeficiency virus-1 (HIV-1), the stabilization of which has been shown to suppress viral gene expression and replication. Our method is based on the generation of molecular fragment small libraries, screened against the target to further elaborate them into lead compounds. We screened 150 small molecules, composed by structurally and chemically different fragments, selected from commercially available and in-house compounds; synthetic elaboration yielded several G4 ligands and two final G4 binders, both embedding an amidoxime moiety; one of these two compounds showed preferential binding for the HIV-1 LTR G4. This work presents the discovery of a novel potential pharmacophore and highlights the possibility to apply a fragment-based approach to develop G4 ligands with unexpected chemical features.

Differences in affinity of arylstilbazolium derivatives to tetraplex structures

2011 ◽  
Vol 65 (2) ◽  
Author(s):  
Izabella Czerwinska ◽  
Bernard Juskowiak
Keyword(s):  
Small Molecules ◽  
Therapeutic Agent ◽  
Equilibrium Dialysis ◽  
Structural Features ◽  
Acid Number ◽  
Strong Interactions ◽  
Dna Structures ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Important Field

AbstractResearch into the interactions of small molecules (ligands) with DNA is a very important field of biochemistry. A ligand interacts with a DNA structure in many ways, depending on the structural features of the ligand (the presence of rings, substituent groups, length of bonds, etc.) or nucleic acid (number and association of strands, base sequence etc.). This study reports on an investigation of the preferential binding of arylstilbazolium ligands to a four-stranded DNA. For this purpose, an equilibrium dialysis was used. Equilibrium dialysis is a versatile method which enables many DNA structures to be investigated at the same time. A dozen different DNA structures of (single-stranded, double-stranded (duplex), triple-stranded (triplex), and four-stranded (tetraplex)) were involved in experiments with each ligand. Following the dissociation of DNA-ligand complexes by SDS, the concentration of the ligand bound was calculated from fluorescence and absorbance calibration curves. As a result, the amount of the ligand bound was directly related to the ligand-binding affinity. Equilibrium dialysis was used as a powerful tool to indicate which of the arylstilbazolium ligands investigated was the best therapeutic agent targeting G-quadruplex. Arylstilbazolium derivatives demonstrated strong interactions with the DNA samples used in the assay. The most interesting finding was a selective, preferential binding of anthryl derivative to c-MYC DNA (c-MYC is a DNA sequence that appears in an oncogene). Furthermore, as this derivative binds preferentially to one of the triplexes investigated, it can find an application in the TFO-triplex forming oligonucleotides which are used in gene therapy.

scholarly journals Integrative analysis reveals RNA G-Quadruplexes in UTRs are selectively constrained and enriched for functional associations

2019 ◽  
Author(s):  
David S.M. Lee ◽  
Louis R. Ghanem ◽  
Yoseph Barash
Keyword(s):  
Regulatory Networks ◽  
Rna Binding ◽  
Purifying Selection ◽  
Regulatory Elements ◽  
Messenger Rnas ◽  
Multiple Sources ◽  
Protein Coding ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Missense Variation

ABSTRACTIdentifying regulatory elements in the noncoding genome is a fundamental challenge in biology. G-quadruplex (G4) sequences are abundant in untranslated regions (UTRs) of human messenger RNAs, but their functional importance remains unclear. By integrating multiple sources of genetic and genomic data, we show that putative G-quadruplex forming sequences (pG4) in 5’ and 3’ UTRs are selectively constrained, and enriched for cis-eQTLs and RNA-binding protein (RBP) interactions. Using over 15,000 whole-genome sequences, we uncover a degree of negative (purifying) selection in UTR pG4s comparable to that of missense variation in protein-coding sequences. In parallel, we identify new proteins with evidence for preferential binding at pG4s from ENCODE annotations, and delineate putative regulatory networks composed of shared binding targets. Finally, by mapping variants in the NIH GWAS Catalogue and ClinVar, we find enrichment for disease-associated variation in 3’UTR pG4s. At a GWAS pG4-variant associated with hypertension in HSPB7, we uncover robust allelic imbalance in GTEx RNA-seq across multiple tissues, suggesting that changes in gene expression associated with pG4 disruption underlie the observed phenotypic association. Taken together, our results establish UTR G-quadruplexes as important cis-regulatory features, and point to a putative link between disruption within UTR pG4 and susceptibility to human disease.

Interaction of Malachite Green with Guanine-Rich Single-Stranded DNA: Preferential Binding to a G-Quadruplex

2007 ◽  
Vol 119 (48) ◽  
pp. 9465-9467 ◽  
Author(s):  
Achikanath C. Bhasikuttan ◽  
Jyotirmayee Mohanty ◽  
Haridas Pal
Keyword(s):  
Malachite Green ◽  
Single Stranded Dna ◽  
G Quadruplex ◽  
Preferential Binding

scholarly journals Residues in the RecQ C-terminal Domain of the Human Werner Syndrome Helicase Are Involved in Unwinding G-quadruplex DNA

2017 ◽  
Vol 292 (8) ◽  
pp. 3154-3163 ◽  
Author(s):  
Amit Ketkar ◽  
Markus Voehler ◽  
Tresor Mukiza ◽  
Robert L. Eoff
Keyword(s):  
Werner Syndrome ◽  
Nmr Studies ◽  
Quadruplex Dna ◽  
G4 Dna ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Werner Syndrome Protein ◽  
Efficient Processing ◽  
Significant Block ◽  
Syndrome Protein

The structural and biophysical properties typically associated with G-quadruplex (G4) structures render them a significant block for DNA replication, which must be overcome for cell division to occur. The Werner syndrome protein (WRN) is a RecQ family helicase that has been implicated in the efficient processing of G4 DNA structures. The aim of this study was to identify the residues of WRN involved in the binding and ATPase-driven unwinding of G4 DNA. Using a c-Myc G4 DNA model sequence and recombinant WRN, we have determined that the RecQ-C-terminal (RQC) domain of WRN imparts a 2-fold preference for binding to G4 DNA relative to non-G4 DNA substrates. NMR studies identified residues involved specifically in interactions with G4 DNA. Three of the amino acids in the WRN RQC domain that exhibited the largest G4-specific changes in NMR signal were then mutated alone or in combination. Mutating individual residues implicated in G4 binding had a modest effect on WRN binding to DNA, decreasing the preference for G4 substrates by ∼25%. Mutating two G4-interacting residues (T1024G and T1086G) abrogated preferential binding of WRN to G4 DNA. Very modest decreases in G4 DNA-stimulated ATPase activity were observed for the mutant enzymes. Most strikingly, G4 unwinding by WRN was inhibited ∼50% for all three point mutants and >90% for the WRN double mutant (T1024G/T1086G) relative to normal B-form dsDNA substrates. Our work has helped to identify residues in the WRN RQC domain that are involved specifically in the interaction with G4 DNA.

Exploring the Binding of Calothrixin A to the G-Quadruplex from the c-myc Oncogene Promotor

2009 ◽  
Vol 62 (11) ◽  
pp. 1544 ◽  
Author(s):  
Elisabeth A. Owen ◽  
Max A. Keniry
Keyword(s):  
Fluorescence Emission ◽  
Myc Oncogene ◽  
Double Stranded Dna ◽  
Vitro Binding ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Displacement Experiments ◽  
Order Of Magnitude ◽  
Dna Quadruplexes

Calothrixin A, a bioactive pentacyclic metabolite from the cyanobacteria Calothrix, has potent antiproliferative behaviour against several cancer cell lines. The in vitro binding of calothrixin A to the DNA quadruplex formed at the promotor region of c-myc was investigated by monitoring changes in the fluorescence emission of 2-aminopurine (2Ap)-substituted analogues of the native Pu22 sequence d(TGAGGGTGGGGAGGGTGGGGAA) on titration with calothrixin A and N-methoxymethyl-calothrixin B. Calothrixin A binds to Pu22 and its constituent loop isomers with a micromolar dissociation constant whereas N-methoxymethyl-calothrixin B has over an order of magnitude lower affinity. Competitive displacement experiments with double-stranded DNA showed preferential binding of calothrixin A to the Pu22 quadruplex compared with double-stranded DNA. The association of calothrixin A with DNA quadruplexes is the first direct evidence that calothrixin A binds to DNA and may aid in the understanding of the bioactivity of the calothrixins.

scholarly journals Novel Indolocarbazole Derivative 12-(α-L-arabinopyranosyl)indolo[2,3-a]pyrrolo[3,4-c]carbazole-5,7-dione Is a Preferred c-MycGuanine Quadruplex Ligand

2011 ◽  
Vol 2011 ◽  
pp. 1-8 ◽  
Author(s):  
Dmitry N. Kaluzhny ◽  
Anna K. Shchyolkina ◽  
Nikolay S. Ilyinsky ◽  
Olga F. Borisova ◽  
Alexander A. Shtil
Keyword(s):  
Double Helix ◽  
Human Tumor ◽  
State Level ◽  
Transplanted Tumors ◽  
Human Tumor Cell ◽  
Human Tumor Cell Lines ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Quadruplex Formation ◽  
Dna Double Helix

The indolocarbazole derivative 12-(α-L-arabinopyranosyl)indolo[2,3-a]pyrrolo[3,4-c]carbazole-5,7-dione (AIC) has demonstrated a high potency (at nanomolar to submicromolar concentrations) towards the NCI panel of human tumor cell lines and transplanted tumors. Intercalation into the DNA double helix has been identified as an important prerequisite for AIC cytotoxicity. In this study, we provide evidence for preferential binding to the G-quadruplex derived from the c-Myconcogene promoter (Pu18 d(AG3TG4)2; G-c-Myc). The association constant for AIC:G-c-Myccomplex was ~100 times and 10 times greater than the respective values for the complexes AIC:c-Mycduplex and AIC:telomeric d(TTAGGG)4G-quadruplex. The concentrations at which AIC formed complexes with G-c-Mycwere close to those that attenuated the steady-state level of the c-MycmRNA in the human HCT116 colon carcinoma cell line. We suggest that preferential binding of AIC to G-c-Mycrather than to the c-Mycduplex might favor the quadruplex formation in the cells, thereby contributing to downregulation of the c-Mycexpression by AIC.

scholarly journals Specific suppression of D-RNA G-quadruplex–protein interaction with an L-RNA aptamer

2020 ◽  
Vol 48 (18) ◽  
pp. 10125-10141 ◽  
Author(s):  
Mubarak I Umar ◽  
Chun Kit Kwok
Keyword(s):  
Protein Interaction ◽  
Protein Interactions ◽  
In Vitro Selection ◽  
Rna Aptamer ◽  
Stem Loop ◽  
Stem Loop Structure ◽  
G Quadruplex ◽  
Preferential Binding ◽  
Better Than

Abstract G-quadruplexes (G4s) are nucleic acid structure motifs that are of significance in chemistry and biology. The function of G4s is often governed by their interaction with G4-binding proteins. Few categories of G4-specific tools have been developed to inhibit G4–protein interactions; however, until now there is no aptamer tool being developed to do so. Herein, we present a novel L-RNA aptamer that can generally bind to D-RNA G-quadruplex (rG4) structure, and interfere with rG4–protein interaction. Using hTERC rG4 as the target for in vitro selection, we report the shortest L-aptamer being developed so far, with only 25 nucleotides. Notably, this new aptamer, L-Apt.4-1c, adopts a stem–loop structure with the loop folding into an rG4 motif with two G-quartet, demonstrates preferential binding toward rG4s over non-G4s and DNA G-quadruplexes (dG4s), and suppresses hTERC rG4–nucleolin interactions. We also show that inhibition of rG4–protein interaction using L-RNA aptamer L-Apt.4-1c is comparable to or better than G4-specific ligands such as carboxypyridostatin and QUMA-1 respectively, highlighting that our approach and findings expand the current G4 toolbox, and open a new avenue for diverse applications.

Sign in / Sign up

Export Citation Format

Share Document