scholarly journals Antigenic variation of a cysteine-rich protein in Giardia lamblia.

1988 ◽  
Vol 167 (1) ◽  
pp. 109-118 ◽  
Author(s):  
R D Adam ◽  
A Aggarwal ◽  
A A Lal ◽  
V F de La Cruz ◽  
T McCutchan ◽  
...  
Keyword(s):  
Amino Acid ◽  
Giardia Lamblia ◽  
Gene Locus ◽  
Tandem Repeats ◽  
Antigenic Variation ◽  
Putative Amino Acid Sequence ◽  
Expression Library ◽  
Cysteine Rich Protein ◽  
Cysteine Content

The WB isolate of Giardia lamblia expresses a cysteine-rich 170-kD surface antigen (CRP170) that undergoes antigenic variation. An (6E7), cytotoxic for isolates expressing CRP170, was used in another study to select antigenic variants from clones of the WB isolate of Giardia. CRP170 was replaced by surface-labeled bands ranging in size from approximately 50 to 170 kD. In this study, mAb 6E7 was used to isolate a 1-kb portion of the CRP170 gene (M2-1) from a lambda gt 11 expression library. The M2-1 clone hybridized to a 5.4-kb transcript from isolates expressing CRP170 but did not hybridize to RNA from antigenic variants. Evidence was found for frequent rearrangements at the CRP170 gene locus. DNA sequencing of the M2-1 clone revealed the presence of long tandem repeats. The putative amino acid sequence of M2-1 reveals a 12% cysteine content, and CRP170 is readily labeled in vivo with cysteine.

scholarly journals Antigens of Mycobacterium tuberculosis Expressed during Preclinical Tuberculosis: Serological Immunodominance of Proteins with Repetitive Amino Acid Sequences

2001 ◽  
Vol 69 (6) ◽  
pp. 4185-4191 ◽  
Author(s):  
K. K. Singh ◽  
X. Zhang ◽  
A. S. Patibandla ◽  
P. Chien ◽  
S. Laal
Keyword(s):  
Mycobacterium Tuberculosis ◽  
Amino Acid ◽  
Tandem Repeats ◽  
Response Regulator ◽  
Amino Acid Sequences ◽  
Expression Library ◽  
Immunodeficiency Virus ◽  
Two Component Signal Transduction ◽  
Aerosol Infection

ABSTRACT Four antigens of Mycobacterium tuberculosisthat are expressed in vivo after aerosol infection but prior to the development of clinical tuberculosis (TB) in rabbits were identified by immunoscreening of an expression library of M. tuberculosis genomic DNA with sera obtained 5 weeks postinfection. Three of the proteins identified, PirG (Rv3810), polymorphic GC-repetitive sequence (PE-PGRS; Rv3367), and proline-threonine repetitive protein (PTRP) (Rv0538), have multiple tandem repeats of unique amino acid sequences and have characteristics of surface or secreted proteins. The fourth protein, MtrA (Rv3246c), is a response regulator of a putative two-component signal transduction system, mtrA-mtrB, ofM. tuberculosis. All four antigens were recognized by pooled sera from TB patients and not from healthy controls, confirming their in vivo expression during active infection in humans. Three of the antigens (PE-PGRS, PTRP, and MtrA) were also recognized by retrospective preclinical TB sera obtained, prior to the clinical manifestation of TB, from human immunodeficiency virus-TB patients, suggesting that they are potential candidates for devising diagnostic tests for active, preclinical TB.

Association of the brain anion exchanger, AE3, with the repeat domain of ankyrin

1993 ◽  
Vol 105 (4) ◽  
pp. 1137-1142 ◽  
Author(s):  
C.W. Morgans ◽  
R.R. Kopito
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Anion Exchanger ◽  
Deletion Mutant ◽  
Tandem Repeats ◽  
Structural Homology ◽  
Terminal Domain ◽  
Repeat Domain ◽  
The Brain

The 89 kDa NH2-terminal domain of erythrocyte ankyrin is composed almost entirely of 22 tandem repeats of a 33 amino acid sequence and constitutes the binding site for the cytoplasmic NH2-terminal domain of the erythrocyte anion exchanger, AE1. We have developed an assay to evaluate the in vivo interaction between a fragment of ankyrin corresponding to this domain (ANK90) and two non-erythroid anion exchangers, AE2 and AE3, that share considerable structural homology with AE1. Association was assessed by co-immunoprecipitation of ANK90-anion exchanger complexes from detergent extracts of cells cotransfected with plasmids encoding the ankyrin fragment and the anion exchanger or mutants thereof. ANK90 was co-immunoprecipitated with AE1 but not with an AE1 deletion mutant lacking the cytoplasmic NH2-terminal domain. Using this assay, we show that the brain anion exchanger AE3, but not the closely related homologue, AE2, is capable of binding to ankyrin.

Tandem Amino Acid Repeats From Trypanosoma cruzi Shed Antigens Increase the Half-Life of Proteins in Blood

Blood ◽  
1999 ◽  
Vol 93 (6) ◽  
pp. 2025-2032 ◽  
Author(s):  
Carlos A. Buscaglia ◽  
Julieta Alfonso ◽  
Oscar Campetella ◽  
Alberto C.C. Frasch
Keyword(s):  
Amino Acid ◽  
Trypanosoma Cruzi ◽  
Half Life ◽  
Tandem Repeats ◽  
Sialidase Activity ◽  
Chimeric Enzymes ◽  
Amino Acid Repeats ◽  
Functional Aspects ◽  
Glutathione S Transferases

Proteins containing amino acid repeats are widespread among protozoan parasites. It has been suggested that these repetitive structures act as immunomodulators, but other functional aspects may be of primary importance. We have recently suggested that tandem repeats present in Trypanosoma cruzi trans-sialidase stabilize the catalytic activity in blood. Because the parasite releasestrans-sialidase, this delayed clearance of the enzyme might have implications in vivo. In the present work, the ability of repetitive units from different T. cruzi molecules in stabilizing trans-sialidase activity in blood was evaluated. It is shown that repeats present on T. cruzi shed proteins (antigens 13 and Shed-Acute-Phase-Antigen [SAPA]) increase trans-sialidase half-life in blood from 7 to almost 35 hours. Conversely, those repeats present in intracellular T. cruzi proteins only increase the enzyme half-life in blood up to 15 hours. Despite these results, comparative analysis of structural and catalytic properties of both groups of chimeric enzymes show no substantial differences. Interestingly, antigens 13 and SAPA also increase the persistence in blood of chimeric glutathione S-transferases, thus suggesting that this effect is inherent to these repeats and independent of the carrier protein. Although the molecular basis of this phenomenon is still uncertain, its biotechnological potential can be envisaged.

scholarly journals The cysteine-rich protein gene family of Giardia lamblia: loss of the CRP170 gene in an antigenic variant.

1992 ◽  
Vol 12 (3) ◽  
pp. 1194-1201 ◽  
Author(s):  
R D Adam ◽  
Y M Yang ◽  
T E Nash
Keyword(s):  
Giardia Lamblia ◽  
Antigenic Variant ◽  
Amino Acid Homology ◽  
Variable Expression ◽  
Cysteine Rich Protein ◽  
Pair Sequence ◽  
Terminal Amino ◽  
Membrane Anchoring

Giardia lamblia trophozoites demonstrate variable expression of a repertoire of cysteine-rich surface antigens in vitro and in vivo. The size of the repertoire has been estimated at 20 to 184, and specific variants can be detected after approximately 12 generations of in vitro growth for the WB isolate. In earlier studies, we cloned a portion of the gene for a 170-kDa surface antigen (CRP170) and demonstrated by DNA sequencing that it was cysteine rich (12%) and contained 2.6 copies of a tandemly repeated 195-bp pair sequence. The clone hybridized to multiple bands on a Southern blot of G. lamblia DNA in a pattern that was variable among the cloned lines but did not correlate with expression of CRP170. We have now cloned a nearly full length cDNA as well as genomic clones for CRP170 from the WBA6 cloned isolate. In addition, we have isolated a cDNA clone from the WB1269 line (expressing CRP72), an antigenic variant which was derived from WBA6. Sequence analysis of the CRP170 and CRP72 genes revealed marked C-terminal amino acid homology, suggesting a conserved functional role such as membrane anchoring. The CRP170 repeat oligonucleotide hybridized to a stairstep of bands approximately 6 kb in size on HindIII-digested WBA6 DNA representing the expressed copy(ies) of CRP170. In contrast, there was no hybridization to a fragment of similar size in WB1269, suggesting that WB1269 trophozoites have lost the expressed copy of the CRP170 gene.

scholarly journals The cysteine-rich protein gene family of Giardia lamblia: loss of the CRP170 gene in an antigenic variant

1992 ◽  
Vol 12 (3) ◽  
pp. 1194-1201
Author(s):  
R D Adam ◽  
Y M Yang ◽  
T E Nash
Keyword(s):  
Giardia Lamblia ◽  
Antigenic Variant ◽  
Amino Acid Homology ◽  
Variable Expression ◽  
Cysteine Rich Protein ◽  
Pair Sequence ◽  
Terminal Amino ◽  
Membrane Anchoring

Giardia lamblia trophozoites demonstrate variable expression of a repertoire of cysteine-rich surface antigens in vitro and in vivo. The size of the repertoire has been estimated at 20 to 184, and specific variants can be detected after approximately 12 generations of in vitro growth for the WB isolate. In earlier studies, we cloned a portion of the gene for a 170-kDa surface antigen (CRP170) and demonstrated by DNA sequencing that it was cysteine rich (12%) and contained 2.6 copies of a tandemly repeated 195-bp pair sequence. The clone hybridized to multiple bands on a Southern blot of G. lamblia DNA in a pattern that was variable among the cloned lines but did not correlate with expression of CRP170. We have now cloned a nearly full length cDNA as well as genomic clones for CRP170 from the WBA6 cloned isolate. In addition, we have isolated a cDNA clone from the WB1269 line (expressing CRP72), an antigenic variant which was derived from WBA6. Sequence analysis of the CRP170 and CRP72 genes revealed marked C-terminal amino acid homology, suggesting a conserved functional role such as membrane anchoring. The CRP170 repeat oligonucleotide hybridized to a stairstep of bands approximately 6 kb in size on HindIII-digested WBA6 DNA representing the expressed copy(ies) of CRP170. In contrast, there was no hybridization to a fragment of similar size in WB1269, suggesting that WB1269 trophozoites have lost the expressed copy of the CRP170 gene.

scholarly journals A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization

1994 ◽  
Vol 300 (2) ◽  
pp. 295-298 ◽  
Author(s):  
V Shankar ◽  
M S Gilmore ◽  
R C Elkins ◽  
G P Sachdev
Keyword(s):  
Amino Acid ◽  
Tandem Repeats ◽  
Polyclonal Antibodies ◽  
Cdna Expression Library ◽  
Expression Library ◽  
Unique Type ◽  
Specific Affinity ◽  
Normal Human ◽  
Human Trachea ◽  
Airway Mucin

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

scholarly journals Antigenic variation of Giardia lamblia in vivo.

1988 ◽  
Vol 56 (6) ◽  
pp. 1420-1423 ◽  
Author(s):  
A Aggarwal ◽  
T E Nash
Keyword(s):  
Giardia Lamblia ◽  
Antigenic Variation

scholarly journals Cloning and Molecular Characterization of an Immunogenic LigA Protein of Leptospira interrogans

2002 ◽  
Vol 70 (11) ◽  
pp. 5924-5930 ◽  
Author(s):  
Raghavan U. M. Palaniappan ◽  
Yung-Fu Chang ◽  
S. S. D. Jusuf ◽  
S. Artiushin ◽  
John F. Timoney ◽  
...  
Keyword(s):  
Amino Acid ◽  
Structure Prediction ◽  
Tandem Repeats ◽  
Secondary Structure Prediction ◽  
Protein A ◽  
Immunoblot Analysis ◽  
Leptospira Interrogans ◽  
Reading Frame

ABSTRACT A clone expressing a novel immunoreactive leptospiral immunoglobulin-like protein A of 130 kDa (LigA) from Leptospira interrogans serovar pomona type kennewicki was isolated by screening a genomic DNA library with serum from a mare that had recently aborted due to leptospiral infection. LigA is encoded by an open reading frame of 3,675 bp, and the deduced amino acid sequence consists of a series of 90-amino-acid tandem repeats. A search of the NCBI database found that homology of the LigA repeat region was limited to an immunoglobulin-like domain of the bacterial intimin binding protein of Escherichia coli, the cell adhesion domain of Clostridium acetobutylicum, and the invasin of Yersinia pestis. Secondary structure prediction analysis indicates that LigA consists mostly of beta sheets with a few alpha-helical regions. No LigA was detectable by immunoblot analysis of lysates of the leptospires grown in vitro at 30°C or when cultures were shifted to 37°C. Strikingly, immunohistochemistry on kidney from leptospira-infected hamsters demonstrated LigA expression. These findings suggest that LigA is specifically induced only in vivo. Sera from horses, which aborted as a result of natural Leptospira infection, strongly recognize LigA. LigA is the first leptospiral protein described to have 12 tandem repeats and is also the first to be expressed only during infection. Thus, LigA may have value in serodiagnosis or as a protective immunogen in novel vaccines.

scholarly journals Antigenic variation in Giardia lamblia and the host's immune response

1997 ◽  
Vol 352 (1359) ◽  
pp. 1369-1375 ◽  
Author(s):  
Theodore E. Nash
Keyword(s):  
Giardia Lamblia ◽  
Antigenic Variation ◽  
Protozoan Parasite ◽  
Scid Mice ◽  
Surface Proteins ◽  
Mouse Strains ◽  
Post Inoculation ◽  
Immune Pressure ◽  
Selection Of

Giardia lamblia , a protozoan parasite of the small intestine of humans and other animals, undergoes surface antigenic variation. The antigens involved belong to a family of variant–specific surface proteins (VSPs), which are unique, cysteine–rich zinc finger proteins. The patterns of infection in humans and animals fail to show the expected cyclical waves of increasing and decreasing numbers of parasites expressing unique VSPs. Nevertheless, changes in VSP expression occur within the population in vivo owing to selection of VSPs by both immune and non–immune mechanisms. After inoculation of a single G. lamblia clone (able to persist in in the absence of immune pressure) expressing one VSP (greater than 90 per cent) into mice or humans, the original VSP continues to be expressed until 2 weeks post inoculation (p.i.), when many other VSPs gradually replace it. Selection by immune–mediated processes is suggested because switching occurs at the same time that humoral responses are first detected. In most mouse strains, switching also occurs at about two weeks. Almost all trophozoites are eliminated at three weeks (p.i.), but a barely detectable infection persists over months. In neonatal mice, apparent self–cure is delayed until the sixth or seventh week. Antigenic switching does not occur in adult or neonatal SCID mice, but does occur in neonatal nude mice, thus implicating B–cell–mediated mechanisms in immune switching. Not all VSPs are expressed to the same degree in vivo . Some VSPs appear to be preferentially selected whereas others are eliminated on a non–immune basis. In infections in which immunity does not play a role, such as in SCID mice, and during the first week of infection in immunocompetent mice or gerbils, persisting VSPs are preferentially expressed and maintained whereas non–persisting VSPs are replaced within the first week of infection. The purpose of antigenic variation may be presentation of a wide assortment of VSPs to hosts, increasing the chance of a successful initial infection or reinfection. Immune selection of variants comes into play following biological selection.

Sign in / Sign up

Export Citation Format

Share Document