scholarly journals A novel human airway mucin cDNA encodes a protein with unique tandem-repeat organization

1994 ◽  
Vol 300 (2) ◽  
pp. 295-298 ◽  
Author(s):  
V Shankar ◽  
M S Gilmore ◽  
R C Elkins ◽  
G P Sachdev
Keyword(s):  
Amino Acid ◽  
Tandem Repeats ◽  
Polyclonal Antibodies ◽  
Cdna Expression Library ◽  
Expression Library ◽  
Unique Type ◽  
Specific Affinity ◽  
Normal Human ◽  
Human Trachea ◽  
Airway Mucin

Highly specific affinity-purified polyclonal antibodies against deglycosylated human tracheobronchial mucin was used to select immunoreactive clones from a Uni-ZAP cDNA expression library prepared from normal human tracheal mRNA. The largest of three positive clones, designated pAM1, which reacted strongly with the polyclonal antibodies, was further characterized. Sequence analyses revealed a partial 941 bp cDNA that encoded a 313-amino-acid polypeptide. Bases 3-892 consisted of imperfect 41-nucleotide tandem repeats (CCAGGAGGGGACACCGGGTTCACGAGCTGCCCACGCCCTCT) that encoded a unique polypeptide with two types of consensus repeats, TSCPRPLQEGTRV and TSCPRPLQEGTPGSRAAHALSRRGHRVHELPTSSPGGDTGF. The overall composition of the deduced amino acid sequence matched that expected for a mucin protein core and is rich in serine, threonine, proline, glycine and alanine (approximately 51%). Northern blots probed with the mucin cDNA exhibited intense polydisperse hybridization bands with RNA isolated from normal human trachea and cystic-fibrosis bronchus. The data indicate that mucin encoded by clone pAM1 represents a unique type of peptide organization which has not been described in mucin cDNAs reported thus far.

scholarly journals Molecular cloning of a major human gall bladder mucin: complete C-terminal sequence and genomic organization of MUC5B

1997 ◽  
Vol 324 (1) ◽  
pp. 295-303 ◽  
Author(s):  
Andrew C. KEATES ◽  
David P. NUNES ◽  
Nezam H. AFDHAL ◽  
Robert F. TROXLER ◽  
Gwynneth D. OFFNER
Keyword(s):  
Gall Bladder ◽  
Von Willebrand Factor ◽  
Tandem Repeats ◽  
Cholesterol Gallstone ◽  
Gallstone Disease ◽  
Repetitive Sequences ◽  
Cdna Expression Library ◽  
Expression Library ◽  
Von Willebrand ◽  
Willebrand Factor

Gall bladder mucin has been shown to play a central role in the pathogenesis of cholesterol gallstone disease. While cloning and sequencing studies have provided a wealth of information on the structure of other gastrointestinal and respiratory mucins, nothing is known about the primary structure of human gall bladder mucin. In this study, we show that the tracheobronchial mucin MUC5B is a major mucin gene product expressed in the gall bladder. Antibodies directed against deglycosylated human gall bladder mucin were used to screen a gall bladder cDNA expression library, and most of the isolated clones contained repetitive sequences nearly identical with those in the tandem repeat region of MUC5B. An additional clone (hGBM2-3) contained an open reading frame coding for a 389 residue cysteine-rich sequence. The arrangement of cysteine residues in this sequence was very similar to that in the C-terminal regions of MUC2, MUC5AC and human von Willebrand factor. This cysteine-rich sequence was connected to a series of degenerate MUC5B tandem repeats in a 7.5 kb HincII genomic DNA fragment. This fragment, with ten exons and nine introns, contained MUC5B repeats in exon 1 and a 469 residue cysteine-rich sequence in exons 2–10 that provided a 152 nucleotide overlap with cDNA clone hGBM2-3. Interestingly, the exon–intron junctions in the MUC5B genomic fragment occurred at positions equivalent to those in the D4 domain of human von Willebrand factor, suggesting that these proteins evolved from a common evolutionary ancestor through addition or deletion of exons encoding functional domains.

scholarly journals Structural features of the low-molecular-mass human salivary mucin

1992 ◽  
Vol 287 (2) ◽  
pp. 639-643 ◽  
Author(s):  
M S Reddy ◽  
L A Bobek ◽  
G G Haraszthy ◽  
A R Biesbrock ◽  
M J Levine
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Molecular Mass ◽  
Gel Filtration ◽  
Structural Features ◽  
Cdna Expression Library ◽  
Cdna Clones ◽  
Expression Library ◽  
Mrna Species ◽  
Salivary Mucin

The low-molecular-mass human salivary mucin has at least two isoforms, MG2a and MG2b, that differ primarily in their sialic acid and fucose content. In this study, we characterize further these isoforms, particularly their peptide moieties. Trypsin digests of MG2a and MG2b yielded high- and low-molecular-mass glycopeptides following gel filtration on Sephacryl S-300. The larger glycopeptides from MG2a and MG2b had similar amino acid compositions and identical N-terminal sequences, suggesting common structural features between their peptides. An oligonucleotide probe generated from the amino acid sequence of the smaller glycopeptide from MG2a was employed in Northern-blot analysis. This probe specifically hybridized to two mRNA species from human submandibular and sublingual glands. A cDNA clone selected from a human submandibular gland cDNA expression library with antibody generated against deglycosylated MG2a also hybridized to these two mRNA species. In both cases, the larger mRNA was polydisperse, and the hybridization signal was more intense in the sublingual gland. In addition, the N-terminal amino acid sequence of the larger glycopeptide was found to be part of one of the selected MG2 cDNA clones.

A member of the HSP90 family from ovineBabesiain China: molecular characterization, phylogenetic analysis and antigenicity

Parasitology ◽  
2015 ◽  
Vol 142 (11) ◽  
pp. 1387-1397 ◽  
Author(s):  
GUIQUAN GUAN ◽  
JUNLONG LIU ◽  
AIHONG LIU ◽  
YOUQUAN LI ◽  
QINGLI NIU ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Amino Acid ◽  
Structural Characteristics ◽  
Heat Shock Protein 90 ◽  
Cellular Transformation ◽  
Amino Acid Sequences ◽  
Enzyme Linked Immunosorbent Assay ◽  
Cdna Expression Library ◽  
Expression Library ◽  
Reading Frame

SUMMARYHeat shock protein 90 (HSP90) is a key component of the molecular chaperone complex essential for activating many signalling proteins involved in the development and progression of pathogenic cellular transformation. AHsp90gene (BQHsp90) was cloned and characterized fromBabesiasp. BQ1 (Lintan), an ovineBabesiaisolate belonging toBabesia motasi-like group, by screening a cDNA expression library and performing rapid amplification of cDNA ends. The full-length cDNA ofBQHsp90is 2399 bp with an open reading frame of 2154 bp encoding a predicted 83 kDa polypeptide with 717 amino acid residues. It shows significant homology and similar structural characteristics toHsp90of other apicomplex organisms. Phylogenetic analysis, based on the HSP90 amino acid sequences, showed that theBabesiagenus is clearly separated from other apicomplexa genera. Five Chinese ovineBabesiaisolates were divided into 2 phylogenetic clusters, namelyBabesiasp. Xinjiang (previously designated a new species) cluster andB. motasi-like cluster which could be further divided into 2 subclusters (Babesiasp. BQ1 (Lintan)/Babesiasp. Tianzhu andBabesiasp. BQ1 (Ningxian)/Babesiasp. Hebei). Finally, the antigenicity of rBQHSP90 protein from prokaryotic expression was also evaluated using western blot and enzyme-linked immunosorbent assay (ELISA).

The zinc finger transcription factor ZBP-89 is a repressor of the human β2-integrin CD11b gene

Blood ◽  
2003 ◽  
Vol 101 (3) ◽  
pp. 894-902 ◽  
Author(s):  
Heiyoung Park ◽  
C. Simon Shelley ◽  
M. Amin Arnaout
Keyword(s):  
Zinc Finger ◽  
Transcriptional Activation ◽  
Phorbol Esters ◽  
Cdna Expression Library ◽  
Expression Library ◽  
Precursor Cell Line ◽  
Normal Human ◽  
Differentiation Marker ◽  
Differentiation Stage

AbstractIntegrin CD11b is a differentiation marker of the myelomonocytic lineage and an important mediator of inflammation. Expression of theCD11b gene is transcriptionally induced as myeloid precursors differentiate into mature cells, then drops as monocytes further differentiate into macrophages. Previous studies have identified elements and factors involved in the transcriptional activation of the CD11b gene during myeloid differentiation, but no data exist regarding potential down-regulatory factors, especially in the later stages of differentiation. Using 2 copies of a GC-rich element (−141 to −110) in the CD11bpromoter, we probed a cDNA expression library for interacting proteins. Three clones were identified among 9.1 million screened, all encoding the DNA-binding domain of the zinc finger factor ZBP-89. Overexpression of ZBP-89 in the monocyte precursor cell line U937 reducedCD11b promoter-driven luciferase activity when U937 cells were induced to differentiate into monocytelike cells using phorbol esters. To identify the differentiation stage at which ZBP-89 repression of the CD11b gene is exerted, the protein level of ZBP-89 was correlated with that of CD11b mRNA in differentiating U937 as well as in normal human monocytes undergoing in vitro differentiation into macrophages. A clear inverse relationship was observed in the latter but not the former state, suggesting that ZBP-89 represses CD11b gene expression during the further differentiation of monocytes into macrophages.

scholarly journals Laminin in the male germ cells of Drosophila.

1992 ◽  
Vol 119 (4) ◽  
pp. 977-988 ◽  
Author(s):  
F Wang ◽  
M Hanske ◽  
K Miedema ◽  
G Klein ◽  
P Ekblom ◽  
...  
Keyword(s):  
Germ Cells ◽  
Polyclonal Antibodies ◽  
Sequence Similarity ◽  
Primary Spermatocyte ◽  
Complete Sequence ◽  
Polyclonal Antiserum ◽  
Cdna Expression Library ◽  
Expression Library ◽  
Male Germ Cells

To study genes that may be crucial for the male germ cell development of Drosophila we screened a cDNA expression library with a polyclonal antiserum against testis proteins of Drosophila hydei. We identified a cDNA fragment that exhibited a complete sequence similarity with the cDNA of the laminin B2 chain, an important component of the extracellular matrix. Transcripts of laminin B2 were detected in the RNA of male germ cells with the polymerase chain reaction and by in situ hybridization. We studied the reaction of different polyclonal antibodies including those against a Drosophila laminin B2-lac fusion protein, the entire Drosophila laminin complex, or against the mouse laminin complex and against laminin A and B1 chains with specific structures in developing male germ cells of Drosophila. Antigenic sites against laminin B2 were found in the lampbrush loops in primary spermatocyte nuclei, in nuclei of spermatids, and in heads of spermatozoa. The axonemes of elongating spermatids react with antibodies against the Drosophila laminin B1, B2 and laminin A chains. The possible biological functions of the laminin in the male germ cells of Drosophila are discussed.

scholarly journals Antigens of Mycobacterium tuberculosis Expressed during Preclinical Tuberculosis: Serological Immunodominance of Proteins with Repetitive Amino Acid Sequences

2001 ◽  
Vol 69 (6) ◽  
pp. 4185-4191 ◽  
Author(s):  
K. K. Singh ◽  
X. Zhang ◽  
A. S. Patibandla ◽  
P. Chien ◽  
S. Laal
Keyword(s):  
Mycobacterium Tuberculosis ◽  
Amino Acid ◽  
Tandem Repeats ◽  
Response Regulator ◽  
Amino Acid Sequences ◽  
Expression Library ◽  
Immunodeficiency Virus ◽  
Two Component Signal Transduction ◽  
Aerosol Infection

ABSTRACT Four antigens of Mycobacterium tuberculosisthat are expressed in vivo after aerosol infection but prior to the development of clinical tuberculosis (TB) in rabbits were identified by immunoscreening of an expression library of M. tuberculosis genomic DNA with sera obtained 5 weeks postinfection. Three of the proteins identified, PirG (Rv3810), polymorphic GC-repetitive sequence (PE-PGRS; Rv3367), and proline-threonine repetitive protein (PTRP) (Rv0538), have multiple tandem repeats of unique amino acid sequences and have characteristics of surface or secreted proteins. The fourth protein, MtrA (Rv3246c), is a response regulator of a putative two-component signal transduction system, mtrA-mtrB, ofM. tuberculosis. All four antigens were recognized by pooled sera from TB patients and not from healthy controls, confirming their in vivo expression during active infection in humans. Three of the antigens (PE-PGRS, PTRP, and MtrA) were also recognized by retrospective preclinical TB sera obtained, prior to the clinical manifestation of TB, from human immunodeficiency virus-TB patients, suggesting that they are potential candidates for devising diagnostic tests for active, preclinical TB.

Molecular cloning and nucleotide sequence analysis of complementary DNA for bullfrog prolactin

1990 ◽  
Vol 5 (3) ◽  
pp. 281-287 ◽  
Author(s):  
N. Takahashi ◽  
K. Yoshihama ◽  
S. Kikuyama ◽  
K. Yamamoto ◽  
K. Wakabayashi ◽  
...  
Keyword(s):  
Amino Acid ◽  
Rana Catesbeiana ◽  
Amino Acid Sequences ◽  
Protein Sequencing ◽  
Nucleotide Sequence Analysis ◽  
Cdna Expression Library ◽  
Mrna Levels ◽  
Expression Library ◽  
Untranslated Sequence ◽  
Prolactin Mrna

ABSTRACT A prolactin cDNA was cloned from a cDNA expression library constructed from total RNA of bullfrog (Rana catesbeiana) adenohypophyses by immunoscreening with antiserum against bullfrog prolactin. The cDNA clone thus obtained contained a 249 bp insert. Using this clone as a probe, plaque hybridizations were performed and two additional clones obtained. These clones had a polyadenylation site different from that of the first obtained clone, suggesting that the 3′-untranslated sequence was heterogeneous in length. The longest clone contained 830 bp, which encoded part of the signal peptide and the entire sequence of mature prolactin. The deduced amino acid sequence was in good accord with that determined by direct protein sequencing of purified bullfrog prolactin. The length of the bullfrog prolactin mRNA was estimated by Northern blot analysis to be about 1·0 kb. Homologies of prolactin nucleotide and amino acid sequences between bullfrog and other vertebrates were 64 and 65% for man, 66 and 68% for pig, 61 and 52% for rat, 69 and 74% for chicken, and 50 and 35% for salmon respectively. Highly conserved regions reported for mammalian prolactins also existed in bullfrog prolactin. Homologies of nucleotide and amino acid sequences between prolactin and GH of bullfrog origin were 49 and 25% respectively. Using the cDNA, the content of prolactin mRNA in the pituitary glands of metamorphosing tadpoles was measured. Prolactin mRNA levels rose at the mid-climax stage, suggesting that the increase in plasma and pituitary prolactin levels known to occur at the climax stage accompanies the increase in prolactin synthesis.

scholarly journals Molecular Cloning of an Immunogenic Protein of Baylisascaris procyonis and Expression in Escherichia coli for Use in Developing Improved Serodiagnostic Assays

2010 ◽  
Vol 17 (12) ◽  
pp. 1933-1939 ◽  
Author(s):  
Sriveny Dangoudoubiyam ◽  
Ramesh Vemulapalli ◽  
Kathy Hancock ◽  
Kevin R. Kazacos
Keyword(s):  
Amino Acid ◽  
Tandem Repeats ◽  
Amino Acid Sequences ◽  
Larva Migrans ◽  
Rabbit Serum ◽  
Enzyme Linked Immunosorbent Assay ◽  
Cdna Expression Library ◽  
Diagnostic Assays ◽  
Baylisascaris Procyonis ◽  
Diagnostic Potential

ABSTRACT Larva migrans caused by Baylisascaris procyonis is an important zoonotic disease. Current serological diagnostic assays for this disease depend on the use of the parasite's larval excretory-secretory (ES) antigens. In order to identify genes encoding ES antigens and to generate recombinant antigens for use in diagnostic assays, construction and immunoscreening of a B. procyonis third-stage larva cDNA expression library was performed and resulted in identification of a partial-length cDNA clone encoding an ES antigen, designated repeat antigen 1 (RAG1). The full-length rag1 cDNA contained a 753-bp open reading frame that encoded a protein of 250 amino acids with 12 tandem repeats of a 12-amino-acid long sequence. The rag1 genomic DNA revealed a single intron of 837 bp that separated the 753-bp coding sequence into two exons delimited by canonical splice sites. No nucleotide or amino acid sequences present in the GenBank databases had significant similarity with those of RAG1. We have cloned, expressed, and purified the recombinant RAG1 (rRAG1) and analyzed its diagnostic potential by enzyme-linked immunosorbent assay. Anti-Baylisascaris species-specific rabbit serum showed strong reactivity to rRAG1, while only minimal to no reactivity was observed with sera against the related ascarids Toxocara canis and Ascaris suum, strongly suggesting the specificity of rRAG1. On the basis of these results, the identified RAG1 appears to be a promising diagnostic antigen for the development of serological assays for specific detection of B. procyonis larva migrans.

Molecular Cloning of Bovine Amelogenin cDna

1987 ◽  
Vol 1 (2) ◽  
pp. 293-297 ◽  
Author(s):  
H. Shimokawa ◽  
Y. Ogata ◽  
S. Sasaki ◽  
M.E. Sobel ◽  
C.I. Mcquillan ◽  
...  
Keyword(s):  
Amino Acid ◽  
Molecular Cloning ◽  
Peptide Sequence ◽  
Cdna Expression Library ◽  
Cdna Clones ◽  
Coding Region ◽  
Expression Library ◽  
Amino Acid Homology ◽  
Signal Peptide Sequence ◽  
Cloned Cdna

Molecular cloning of a bovine amelogenin cDNA was accomplished by construction of a cDNA expression library (λgt11 cDNA library) from the bovine ameloblast mRNA and then screening of the library with antibodies to bovine amelogenins. The complete primary structure of an amelogenin was deduced from cloned cDNA. One of the cDNA clones isolated from a bovine ameloblast phage λgt11 library had an 864-base-pair-long insert that encoded a protein with 216 amino acid residues. This cDNA clone appears to represent the complete coding region of amelogenin mRNA, including a putative AUG initiation codon and a signal peptide sequence. The predicted bovine amelogenin sequence has 87% amino acid homology with murine amelogenin.

scholarly journals Dictyostelium discoideum myosin: isolation and characterization of cDNAs encoding the essential light chain.

1988 ◽  
Vol 8 (2) ◽  
pp. 794-801 ◽  
Author(s):  
R L Chisholm ◽  
A M Rushforth ◽  
R S Pollenz ◽  
E R Kuczmarski ◽  
S R Tafuri
Keyword(s):  
Amino Acid ◽  
Amino Acid Sequence ◽  
Dictyostelium Discoideum ◽  
Light Chain ◽  
Single Gene ◽  
Cdna Expression Library ◽  
Cdna Clones ◽  
Expression Library ◽  
Essential Light Chain ◽  
Isolation And Characterization

We used an antibody specific for Dictyostelium discoideum myosin to screen a lambda gt11 cDNA expression library to obtain cDNA clones which encode the Dictyostelium essential myosin light chain (EMLC). The amino acid sequence predicted from the sequence of the cDNA clone showed 31.5% identity with the amino acid sequence of the chicken EMLC. Comparisons of the Dictyostelium EMLC, a nonmuscle cell type, with EMLC sequences from similar MLCs of skeletal- and smooth-muscle origin, showed distinct regions of homology. Much of the observed homology was localized to regions corresponding to consensus Ca2+-binding of E-F hand domains. Southern blot analysis suggested that the Dictyostelium genome contains a single gene encoding the EMLC. Examination of the pattern of EMLC mRNA expression showed that a significant increase in EMLC message levels occurred during the first few hours of development, coinciding with increased actin expression and immediately preceding the period of maximal chemotactic activity.

Sign in / Sign up

Export Citation Format

Share Document