scholarly journals Using stratified medicine in diabetes

2016 ◽  
Vol 38 (1) ◽  
pp. 19-21
Author(s):  
Katharine R. Owen
Keyword(s):  
Islet Cells ◽  
Stratified Medicine ◽  
Insulin Production ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Monogenic Forms Of Diabetes ◽  
Relative Deficiency

Diabetes mellitus is a common long-term condition characterized by raised blood glucose levels secondary to an absolute or relative deficiency of insulin production from the pancreatic islet -cells. Diabetes is highly heterogeneous in terms of aetiology1, making it a good candidate for stratified medicine approaches. Clinical studies have shown that the standard first-line treatments for Type 1 diabetes (insulin) and Type 2 diabetes (metformin) are not applicable to the rarer monogenic forms of diabetes, so in these cases making a molecular diagnosis can help to direct and optimize treatment.

What Breathing Insulin Means for Diabetes Treatment

2006 ◽  
Vol 00 (02) ◽  
Author(s):  
Marc Rendell
Keyword(s):  
Glycosylated Hemoglobin ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Severe Deficiency ◽  
Patients With Diabetes ◽  
Insufficient Response ◽  
Relative Deficiency ◽  
Insulin Secretory Capacity

Type 1 diabetes is a disease of severe deficiency of endogenously secreted insulin. When introduced in the late 1920s, injected insulin treatment proved to be a lifesaving treatment for type 1 patients. The primary abnormality in type 2 diabetes is a relative deficiency of insulin secretory capacity resulting in insufficient response to tissue insulin resistance. Normalization of blood glucose levels is the goal of diabetes treatment.Yet, a large proportion of patients with diabetes fail to meet recommended glycemic goals. Two-thirds of patients (67%) in one survey conducted by the American College of Clinical Endocrinologists failed to meet the target goal of 6.5% glycosylated hemoglobin (HbA1c).1

Advantages and Disadvantages of Realtime Continuous Glucose Monitoring in People with Type 2 Diabetes

2012 ◽  
Vol 08 (01) ◽  
pp. 22 ◽  
Author(s):  
M Susan Walker ◽  
Stephanie J Fonda ◽  
Sara Salkind ◽  
Robert A Vigersky ◽  
◽  
...  
Keyword(s):  
Type 2 Diabetes ◽  
Type 1 Diabetes ◽  
Blood Glucose ◽  
Continuous Glucose Monitoring ◽  
Glucose Monitoring ◽  
Glucose Levels ◽  
Advantages And Disadvantages ◽  
Blood Glucose Levels

Previous research has shown that realtime continuous glucose monitoring (RT-CGM) is a useful clinical and lifestyle aid for people with type 1 diabetes. However, its usefulness and efficacy for people with type 2 diabetes is less known and potentially controversial, given the continuing controversy over the efficacy of self-monitoring of blood glucose (SMBG) in this cohort. This article reviews theextantliterature on RT-CGM for people with type 2 diabetes, and enumerates several of the advantages and disadvantages of this technology from the perspective of providers and patients. Even patients with type 2 diabetes who are not using insulin and/or are relatively well controlled on oral medications have been shown to spend a significant amount of time each day in hyperglycemia. Additional tools beyond SMBG are necessary to enable providers and patients to clearly grasp and manage the frequency and amplitude of glucose excursions in people with type 2 diabetes who are not on insulin. While SMBG is useful for measuring blood glucose levels, patients do not regularly check and SMBG does not enable many to adequately manage blood glucose levels or capture marked and sustained hyperglycemic excursions. RT-CGM systems, valuable diabetes management tools for people with type 1 diabetes or insulin-treated type 2 diabetes, have recently been used in type 2 diabetes patients. Theextantstudies, although few, have demonstrated that the use of RT-CGM has empowered people with type 2 diabetes to improve their glycemic control by making and sustaining healthy lifestyle choices.

Diabetes mellitus

2018 ◽  
Author(s):  
Kevin Shotliff
Keyword(s):  
Diabetes Mellitus ◽  
Insulin Resistance ◽  
Pancreatic Beta Cells ◽  
Insulin Deficiency ◽  
High Blood Glucose ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Uk

Diabetes mellitus, often referred to simply as diabetes, is a syndrome of disordered metabolism (insulin deficiency and/or insulin resistance) resulting in abnormally high blood glucose levels (hyperglycaemia). Currently, 2%–6% of the UK population have diabetes; worldwide, 189 million people were known to have diabetes in 2003 and this may reach 324 million by 2025. Type 1 diabetes is due to the destruction of insulin-producing pancreatic beta cells, and type 2 diabetes to combined insulin resistance and relative insulin deficiency. Other types of diabetes are also recognized. This topic reviews clinical features, diagnosis, and management of diabetes mellitus.

scholarly journals Glucose transporter inhibitor-conjugated insulin mitigates hypoglycemia

2019 ◽  
Vol 116 (22) ◽  
pp. 10744-10748 ◽  
Author(s):  
Jinqiang Wang ◽  
Jicheng Yu ◽  
Yuqi Zhang ◽  
Anna R. Kahkoska ◽  
Zejun Wang ◽  
...  
Keyword(s):  
Glucose Transporter ◽  
Diabetic Mouse ◽  
Insulin Analog ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
Uncontrolled Diabetes ◽  
Increased Risk

Insulin therapy in the setting of type 1 and advanced type 2 diabetes is complicated by increased risk of hypoglycemia. This potentially fatal complication could be mitigated by a glucose-responsive insulin analog. We report an insulin-facilitated glucose transporter (Glut) inhibitor conjugate, in which the insulin molecule is rendered glucose-responsive via conjugation to an inhibitor of Glut. The binding affinity of this insulin analog to endogenous Glut is modulated by plasma and tissue glucose levels. In hyperglycemic conditions (e.g., uncontrolled diabetes or the postprandial state), the in situ-generated insulin analog−Glut complex is driven to dissociate, freeing the insulin analog and glucose-accessible Glut to restore normoglycemia. Upon overdose, enhanced binding of insulin analog to Glut suppresses the glucose transport activity of Glut to attenuate further uptake of glucose. We demonstrate the ability of this insulin conjugate to regulate blood glucose levels within a normal range while mitigating the risk of hypoglycemia in a type 1 diabetic mouse model.

scholarly journals The Role of HbA1C for Diagnosis of Type-2 Diabetes Mellitus - A Review

2016 ◽  
Vol 11 (1) ◽  
pp. 30-32
Author(s):  
Shahana Zabeen ◽  
Sultana Rehana Akhter
Keyword(s):  
Diabetes Mellitus ◽  
Type 2 Diabetes ◽  
Type 2 Diabetes Mellitus ◽  
Large Body ◽  
Vascular Complications ◽  
Glucose Levels ◽  
Blood Glucose Levels

For many years, the diagnosis of diabetes has been made through the laboratory- based measurement of fasting or random blood glucose levels or using OGTT. In the case of diabetes, the major outcome of interest is long term micro vascular complications for which a large body of data has been accumulated leading to the endorsement of HbA1C for diagnosis in many countries worldwide, with some variations in cut-offs and testing strategies.Faridpur Med. Coll. J. Jan 2016;11(1): 30-32

scholarly journals Identification of the Mitochondrial ND1 Gene Carrier of Diabetes Mellitus Type 2 with Blood Samples

2020 ◽  
Vol 3 (2) ◽  
pp. 48-53
Author(s):  
Hindah Sabrina Amin ◽  
Miftahul Mushlih
Keyword(s):  
Diabetes Mellitus ◽  
Nadh Dehydrogenase ◽  
Insulin Production ◽  
Glucose Levels ◽  
Blood Glucose Levels ◽  
The Family ◽  
Impaired Insulin ◽  
Mitochondrial Genotype ◽  
Mitochondrial Nd1

Diabetes Mellitus is a condition where there is an increase in blood glucose levels which is characterized by impaired insulin production or the inability of target tissues to respond to insulin. The purpose of this study was to determine the characteristics of the NADH Dehydrogenase 1 gene in the family of Type 2 Diabetes Mellitus patients. The study used a descriptive exploratory method. The sample came from a family of 5 people with T2D in Sidoarjo. Mitochondrial Genotype Analysis using PCR-Primary Sequencing Forward 5'GAGCAGAACCCAACCTCCGAGCAG3 '(nt2826–2849) and Primary Rivers 5'GATTGTTTGGGCTACTGCTCG3' (nt3728 - 3749). Analysis of the 5 samples used obtained 2 samples that can be analyzed with a band length of 690 bp and 84 bp. Based on the results of primary research, the sample used is difficult to get good amplification results. Only one out of five samples can be amplified properly. The variation of the amplified ND1 gene is found at positions T3031C, G3143C, A3252G, C3303T, C3707T.

scholarly journals Type 2 Diabetes and its Impact on the Immune System

2020 ◽  
Vol 16 (5) ◽  
pp. 442-449 ◽  
Author(s):  
Afiat Berbudi ◽  
Nofri Rahmadika ◽  
Adi Imam Tjahjadi ◽  
Rovina Ruslami
Keyword(s):  
Type 2 Diabetes ◽  
Immune Response ◽  
Blood Glucose ◽  
Infectious Diseases ◽  
Insulin Production ◽  
High Blood Glucose ◽  
Major Health Problem ◽  
Glucose Levels ◽  
Blood Glucose Levels

Introduction:: Type 2 Diabetes (T2D) is a major health problem worldwide. This metabolic disease is indicated by high blood glucose levels due to insufficient insulin production by the pancreas. An inflammatory response occurs as a result of the immune response to high blood glucose levels as well as the presence of inflammatory mediators produced by adipocytes and macrophages in fat tissue. This low and chronic inflammation damages the pancreatic beta cells and leads to insufficient insulin production, which results in hyperglycemia. : Hyperglycemia in diabetes is thought to cause dysfunction of the immune response, which fails to control the spread of invading pathogens in diabetic subjects. Therefore, diabetic subjects are known to more susceptible to infections. The increased prevalence of T2D will increase the incidence of infectious diseases and related comorbidities. Objective: : This review provides an overview of the immunological aspect of T2D and the possible mechanisms that result in increased infections in diabetics. Conclusion: : A better understanding of how immune dysfunctions occur during hyperglycemia can lead to novel treatments and preventions for infectious diseases and T2D comorbidities, thus improving the outcome of infectious disease treatment in T2D patients.

Sign in / Sign up

Export Citation Format

Share Document