scholarly journals Correction: Fluorogenic bidirectional displacement probe-based real-time isothermal DNA amplification and specific visual detection of products

2016 ◽  
Vol 52 (83) ◽  
pp. 12384-12384
Author(s):  
Xiong Ding ◽  
Guoping Wang ◽  
Jingjing Sun ◽  
Tao Zhang ◽  
Ying Mu

Correction for ‘Fluorogenic bidirectional displacement probe-based real-time isothermal DNA amplification and specific visual detection of products’ by Xiong Ding et al., Chem. Commun., 2016, 52, 11438–11441.

2016 ◽  
Vol 52 (76) ◽  
pp. 11438-11441 ◽  
Author(s):  
Xiong Ding ◽  
Guoping Wang ◽  
Jingjing Sun ◽  
Tao Zhang ◽  
Ying Mu

We report an easy-to-design probe as both the primer and the indicator to mediate isothermal DNA amplification with high sensitivity and specificity.


2021 ◽  
Vol 189 ◽  
pp. 109228
Author(s):  
Chenxia Wang ◽  
Zian Yu ◽  
Xiaowei Zhao ◽  
Hongguang Lu ◽  
Qiusheng Wang

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.


Author(s):  
Maryna Sapachova

ObjectiveThe performance of comparative analysis of sensitivity and resultsof detection of avian influenza virus by real time polymerase chainreaction (PCR-RT) and loop-mediated isothermal amplification of thenucleic acids (LAMP) was the main goal of the study.IntroductionAs part of this surveillance study for Avian Influenza both activeand passive surveillance samples were tested using PCR and alsoutilized to validate the LAMP method. Active surveillance samplesinclude pathological material and tracheal and cloacal swabs fromill poultry, which were subsequently assessed for avian influenzaduring diagnosis, and birds collected by hunters. Passive surveillanceincluded environmental samples such as sand and bird faeces.Active surveillance samples were taken mostly from poultry farmsacross Ukraine, where infected birds are required to be diagnosedby State Scientific Research Institute of Laboratory Diagnosticsand Veterinary Sanitary Expertise (SSRILDVSE) by Ukraine Law.Passive surveillance samples were taken primarily during the annualbird migration season. Development of simple, sensitive, and cheapmethods for diagnostics of avian influenza is a very important taskfor practical veterinary medicine. LAMP is one of such methods.The technique is based on isothermal amplification of nucleic acids.It does not require special conditions and equipment (PCR cyclers),therefore it is cheaper in comparison with PCR. Accurate diagnosisis necessary for determining the risk associated with avian influenzain Ukraine and along the Dnipro River during the migratory season.MethodsFor the research, we used PCR-RT commercial kit Bird-Flu-PCR(Ukrzoovetprompostach, Ukraine), LAMP (the protocol has beenoptimized and patented by SSRILDVSE), QIAamp®Viral RNA MiniKit. For the study, we used pathological and biological materials frombirds, which were sent to the SSRILDVSE from all regions of Ukraineaccording to the 2013–2014 State monitoring plan.Set up of the real time PCR reactions and parameters ofamplifications are indicated in the instruction to the kit.The following protocol was used to set up the RT- LAMP: 2.5μL10 X Thermopol buffer, 1 mmol/L betaine, 5 mmol/L MgSO4,1.4 mmol/L - BNTP, 12.5μmol/L SYBR GREEN, 0.5 mmol/LMnCL2, up to 25μL Nuclease-free water, 8 U Bsm DNA polymerase,0.1μM/1 of F3, 0.1μM/1 of B3, 0.8μM/1 of FIP, 0.8μM/1 of BIP,0.4μM/1 of LF, 0.4 of LB, 2μL cDNA.During our work, we used the following optimal temperature andtime for the amplification – 59°C and 60 minutes.The sensitivity of diagnostic kit Bird-Flu-PCR and RT- LAMP wasdetermined by testing cDNA of the reference strain of AIV H5N1,which was provided to us by NSC Institute for Experimental andClinical Veterinary Medicine (Kharkiv, Ukraine). For the standard,we employed concentration in the range of 10.0-0.01 ng/sample.ResultsTable 1.This table shows the reproducibility results obtained by bothmethods. However, taken into account absence of highly pathogenicavian influenza virus circulating in Ukraine during the studied period,it was not possible to confirm these results with protocols of positivesamples.Table 2.It has been established that the sensitivity of PCR-RT kit Bird-Flu-PCR is 0.01 ng/sample for gene M and 0.1 ng/sample for subtypeH5N1.Fig. 1. Visual detection of LAMP products with differentconcentrations of cDNA of avian influenza virus (ng per sample):1 – 10; 2 – 5; 3 – 1.0; 4 – 0.1; 5–7 – 0.01; 8–9 – 0.1; 10 – negative.We have examined the LAMP results using electrophoresis forthe confirmation of visual detection and correct interpretation of theresults (Fig. 2).Fig.2. Electrophoresis results for LAMP products. M –molecular weight marker; 1 – 10.0; 2 – 5.0; 3 – 1.0; 4 – 0.1; 5–7– 0.01; 8 - negative control.It has been established that the sensitivity of LAMP is0.1 ng/sample. Slightly lower sensitivity of LAMP in comparisonto PCR-RT can be explained by visual detection of the products ofthe LAMP reaction.Conclusions1. Sensitivity of both methods is high.2. LAMP is a perspective screening method for the diagnosis ofviral infectious diseases supported by confirmation of positive resultsby PCR-RT.


2015 ◽  
Vol 21 (1-2) ◽  
Author(s):  
N. Czotter ◽  
E. Manduláné Farkas ◽  
R. Lózsa ◽  
I. Ember ◽  
G. Szûcsné Varga ◽  
...  

Several grapevine pathogens are disseminated by propagating material as systemic, but latent infections. Their detection and identification have a basic importance in the production and handling of propagating stocks. Thus several sensitive and reliable diagnostic protocols mostly based on molecular techniques have been developed. Of these methods quantitative real-time PCR (q-PCR) has recently got an emerging importance. Here we collected primer data for the detection and identification of grapevine pathogens which are important in the production of propagating stocks by q-PCR. Additional novel techniques that use DNA amplification, hybridization and  sequencing are also briefly reviewed.


Author(s):  
Irene Vigué‐Guix ◽  
Luis Morís Fernández ◽  
Mireia Torralba Cuello ◽  
Manuela Ruzzoli ◽  
Salvador Soto‐Faraco

Sign in / Sign up

Export Citation Format

Share Document