scholarly journals Root treatment with a Vitamin K 3 derivative: A promising alternative to synthetic fungicides against Botrytis cinerea in tomato plants

2021 ◽  
Author(s):  
Francisco J. García‐Machado ◽  
Ana L. García‐García ◽  
Andrés A. Borges ◽  
David Jiménez‐Arias
Keyword(s):  
Botrytis Cinerea ◽  
Vitamin K ◽  
Promising Alternative ◽  
Tomato Plants ◽  
Root Treatment

scholarly journals First Report of Botrytis cinerea Causing Gray Mold on Greenhouse-Grown Tomato Plants in Mauritius

Plant Disease ◽  
2021 ◽  
Author(s):  
Nooreen Mamode Ally ◽  
Hudaa Neetoo ◽  
Mala Ranghoo-Sanmukhiya ◽  
Shane Hardowar ◽  
Vivian Vally ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Single Cells ◽  
Disease Incidence ◽  
Gray Mold ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Sterile Water ◽  
Susceptible Host ◽  
Tomato Plants ◽  
First Report

Gray mold is one of the most important fungal diseases of greenhouse-grown vegetables (Elad and Shtienberg 1995) and plants grown in open fields (Elad et al. 2007). Its etiological agent, Botrytis cinerea, has a wide host range of over 200 species (Williamson et al. 2007). Greenhouse production of tomato (Lycopersicon esculentum Mill.) is annually threatened by B. cinerea which significantly reduces the yield (Dik and Elad 1999). In August 2019, a disease survey was carried out in a tomato greenhouse cv. ‘Elpida’ located at Camp Thorel in the super-humid agroclimatic zone of Mauritius. Foliar tissues were observed with a fuzzy-like appearance and gray-brown lesions from which several sporophores could be seen developing. In addition, a distinctive “ghost spot” was also observed on unripe tomato fruits. Disease incidence was calculated by randomly counting and rating 100 plants in four replications and was estimated to be 40% in the entire greenhouse. Diseased leaves were cut into small pieces, surface-disinfected using 1% sodium hypochlorite, air-dried and cultured on potato dextrose agar (PDA). Colonies having white to gray fluffy mycelia formed after an incubation period of 7 days at 23°C. Single spore isolates were prepared and one, 405G-19/M, exhibited a daily growth of 11.4 mm, forming pale brown to gray conidia (9.7 x 9.4 μm) in mass as smooth, ellipsoidal to globose single cells and produced tree-like conidiophores. Black, round sclerotia (0.5- 3.0 mm) were formed after 4 weeks post inoculation, immersed in the PDA and scattered unevenly throughout the colonies. Based on these morphological characteristics, the isolates were presumptively identified as B. cinerea Pers. (Elis 1971). A DNeasy Plant Mini Kit (Qiagen, Hilden, Germany) was used for the isolation of DNA from the fungal mycelium followed by PCR amplification and sequencing with primers ITS1F (CTTGGTCATTTAGAGGAAGTAA) (Gardes and Bruns 1993) and ITS4 (TCCTCCGCTTATTGATATGC) (White et al. 1990). The nucleotide sequence obtained (551 bp) (Accession No. MW301135) showed a 99.82-100% identity with over 100 B. cinerea isolates when compared in GenBank (100% with MF741314 from Rubus crataegifolius; Kim et al. 2017). Under greenhouse conditions, 10 healthy tomato plants cv. ‘Elpida’ with two true leaves were sprayed with conidial suspension (1 x 105 conidia/ml) of the isolate 405G-19/M while 10 control plants were inoculated with sterile water. After 7 days post-inoculation, the lesions on the leaves of all inoculated plants were similar to those observed in the greenhouse. No symptoms developed in the plants inoculated with sterile water after 15 days. The original isolate was successfully recovered using the same technique as for the isolation, thus fulfilling Koch’s postulates. Although symptoms of gray mold were occasionally observed on tomatoes previously (Bunwaree and Maudarbaccus, personal communication), to our knowledge, this is the first report that confirmed B. cinerea as the causative agent of gray mold on tomato crops in Mauritius. This disease affects many susceptible host plants (Sarven et al. 2020) such as potatoes, brinjals, strawberries and tomatoes which are all economically important for Mauritius. Results of this research will be useful for reliable identification necessary for the implementation of a proper surveillance, prevention and control approaches in regions affected by this disease.

scholarly journals Comparison of defence responses to Botrytis cinerea infection in tomato plants propagated in vitro and grown in vivo

2013 ◽  
Vol 49 (1-2) ◽  
pp. 115-121 ◽  
Author(s):  
Jacek Patykowski ◽  
Elżbieta Kuźniak ◽  
Henryk Urbaniak
Keyword(s):  
Superoxide Dismutase ◽  
Botrytis Cinerea ◽  
Ascorbate Peroxidase ◽  
Guaiacol Peroxidase ◽  
Activity Increase ◽  
Tomato Plants ◽  
Defence Responses ◽  
Defence Reactions

Defence reactions: O<sub>2<sub> - generation, superoxide dismutase, catalase, guaiacol peroxidase and ascorbate peroxidase activities after <em>B. cinerea</em> infection in tomato plants propagated <em>in vitro</em> and grown <em>in vivo</em> have been compared. Infection resulted in rapid O<sub>2<sub> - generation. Superoxide dismutase activity increase was slower than O<sub>2<sub> - response. In plants propagated <em>in vitro</em> catalase and guaiacol peroxidase activities after infection were induced less strongly than in plants grown <em>in vivo</em>. K<sub>2<sub>HPO<sub>4<sub> pretreatment of plants grown <em>in vitro</em> enhanced significantly the activities of catalase and guaiacol peroxidase after infection. Slight restriction of <em>B. cinerea</em> infection development in <em>in vitro</em> propagated plants pretreated with K<sub>2<sub>HP0<sub>4<sub> was observed.

Author response for "Hormetic doses of UV‐C light decrease the susceptibility of tomato plants to Botrytis cinerea infection"

2020 ◽  
Author(s):  
Hilariòn Vàsquez ◽  
Chayma Ouhibi ◽  
Marine Forges ◽  
Yves Lizzi ◽  
Laurent Urban ◽  
...  
Keyword(s):  
Botrytis Cinerea ◽  
Author Response ◽  
Tomato Plants ◽  
Uv C

Knockout of SlNPR1 enhances tomato plants resistance against Botrytis cinerea by modulating ROS homeostasis and JA / ET signaling pathways

2020 ◽  
Vol 170 (4) ◽  
pp. 569-579
Author(s):  
Rui Li ◽  
Liu Wang ◽  
Yujing Li ◽  
Ruirui Zhao ◽  
Yuelin Zhang ◽  
...  
Keyword(s):  
Signaling Pathways ◽  
Botrytis Cinerea ◽  
Tomato Plants ◽  
Ros Homeostasis
Sign in / Sign up

Export Citation Format

Share Document