scholarly journals First report of Fig badnavirus‐1 associated with Fig mosaic virus in fig in Iraq

2021 ◽  
Vol 44 (1) ◽  
Author(s):  
S. Zagier ◽  
O. Alisawi ◽  
F. Al Fadhal
Keyword(s):  
Mosaic Virus ◽  
First Report ◽  
Fig Mosaic Virus

scholarly journals First Report of Fig mosaic virus Infecting Common Fig (Ficus carica) in China

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 422-422 ◽  
Author(s):  
M. Mijit ◽  
S. F. Li ◽  
S. Zhang ◽  
Z. X. Zhang
Keyword(s):  
Mosaic Virus ◽  
Blot Hybridization ◽  
Ficus Carica ◽  
Pcr Analysis ◽  
Northern Blot Hybridization ◽  
Rt Pcr ◽  
Glycoprotein Precursor ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

The common fig (Ficus carica) is one of the earliest plants domesticated by humans. It has been cultivated in China ever since the early seventh century. Fig fruit is an important traditional Chinese medicine and a fine health food, featuring a unique flavor and rich nutrients. In addition to its great medicinal values, its abundant availability in the Xinjiang province of China has made the fig one of the most popular fruits in the country. One of the major diseases that affect figs is the fig mosaic disease (FMD) (1,4), which was reported in China in 1935 (3). A causal agent of this disease is associated with the Fig mosaic virus (FMV), a negative-strand RNA virus with six RNA segments (2). In 2013, and later during a survey in 2014, fig plants in several orchards in Xinjiang displayed symptoms of a virus-like disease, which was characterized as FMD. These symptoms included chlorotic clearing as well as banding of leaf veins along with various patterns of discoloration, severely distorted leaves, and deformed fruits. Total RNA extracts (TRIzol reagent, Ambion) from 18 symptomatic and four asymptomatic leaf samples were subjected to reverse reaction (RT) assays using M-MLV reverse transcriptase (Promega, Fitchburg, WI) with primer FMV-GP-R (TATTACCTGGATCAACGCAG). PCR analysis of the synthesized cDNA was performed using FMV-specific primers FMV-GP-F (ACTTGCAAAGGCAGATGATA) and FMV-GP-R. Amplicons of 706 bp produced by RT-PCR assays were obtained from most (15 out of 18) of the symptomatic samples; however, none was obtained from the four asymptomatic leaves. The purified amplicons were cloned and sequenced. BLAST analysis of these sequences revealed more than 94% nucleotide identity with glycoprotein precursor (GP) genes of an FMV-Serbia isolate (SB1). One sequence was deposited in NCBI databases, and one sequence was submitted to GenBank (Accession No. KM034915). RNA segments 2 to 6 of FMV were also amplified by RT-PCR and sequenced. These sequences showed 94 to 96% identity with FMV sequences deposited in the NCBI databases. The collected samples were further detected by Northern-blot hybridization with a digoxigenin-labeled RNA probe, which targets the RNA1 genome of the FMV. The result was in line with RT-PCR detection. To our knowledge, this is the first report of FMV in fig trees in China. Considering the economic importance of fig plants and the noxious nature of FMV, this virus poses a great threat to the economy of the fig industry of Xinjiang. Thus, it is important to develop immediate effective quarantine and management of this virus to reduce any further predictable loss. References: (1) T. Elbeaino et al. J. Gen. Virol. 90:1281, 2009. (2) K. Ishikawa et al. J. Gen. Virol. 93:1612, 2012. (3) H. A. Pittman. J. West Aust. Dept. Agric. 12:196, 1935. (4) J. J. Walia et al. Plant Dis. 93:4, 2009.

First report of fig mosaic virus infecting common fig (Ficus carica) in Japan

2012 ◽  
Vol 78 (2) ◽  
pp. 136-139 ◽  
Author(s):  
Kazuya Ishikawa ◽  
Kensaku Maejima ◽  
Susumu Nagashima ◽  
Nobuo Sawamura ◽  
Yusuke Takinami ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Ficus Carica ◽  
First Report ◽  
Common Fig ◽  
Fig Mosaic Virus

scholarly journals First report of fig mosaic virus on fig in Russia

Plant Disease ◽  
2021 ◽  
Author(s):  
Sergei Chirkov ◽  
Svetlana Tsygankova ◽  
Sergey Rastorguev ◽  
Irina Mitrofanova ◽  
Svetlana Chelombit ◽  
...  
Keyword(s):  
New England ◽  
Mosaic Virus ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Rna Extraction ◽  
Mosaic Disease ◽  
Viral Gene ◽  
Illumina Platform ◽  
First Report ◽  
Fig Mosaic Virus

Fig mosaic virus (FMV) (genus Emaravirus in the family Fimoviridae) is considered the etiological agent of fig mosaic disease (FMD) that is recorded in most of the fig growing areas with an average global infection rate of 33%. The multipartite FMV genome is comprised of six negative monocistronic ssRNAs, each of which is separately encapsidated (Preising et al. 2020). Although FMD-like symptoms, which include mosaic, chlorotic ringspots, and oak leaf patterns, were observed in approximately a third of 400 fig accessions in the Nikita Botanical Gardens, Yalta, Russia (Mitrofanova et al. 2016), FMV has not been identified as the causal agent of the disease. In June of 2020, total RNA was isolated from symptomatic leaves of 59 thirty two-year-old trees representing 31 local and 27 introduced Ficus carica L. cultivars and a single F. pseudocarica Miq. tree using RNeasy Plant Mini kit (Qiagen, USA). FMV was tested by RT-PCR using primer sets E5 (Elbeaino et al. 2009) and EMARAVGP (Walia et al. 2009), which amplify a 302-bp fragment of RNA1 and a 468-bp fragment of RNA2, respectively. PCR products of the expected sizes were generated in all samples, indicating a high FMV incidence in the plantings. The genome sequences of FMV isolates from F. carica cvs. Bleuet, Kraps di Hersh, Smena, Temri, and F. pseudocarica (Fig. S1) were determined by high-throughput sequencing on MiSec Illumina platform. Double-stranded RNA was isolated from FMV-positive leaves using Viral Gene-spin™ Viral DNA/RNA Extraction Kit (iNtRON, Korea), followed by cDNA library preparation with the NEBNext® Ultra™ II RNA Library Prep Kit (New England Biolabs, USA). In average, 695,000 quality-filtered 150 bp pair-ended reads per a library were produced and used in a de novo assembly using metaSpades program version 3.14 (Nurk et al. 2017). In each of five samples, BLASTn analysis found six FMV-related contigs. The contigs spanned 99 to 100% of corresponding genomic segments of the most closely related isolates. In addition to FMV, fig cryptic virus-related contigs were also detected in some samples. The FMV contigs covering RNA1 to RNA6 had the highest identity to corresponding genomic segments of isolates AM941711 (96.5 to 96.6%), FM864225 (94.4 to 94.6%), FM991954 (97.9 to 98.2%), AB697863 (96.4 to 96.6%), AB697879 (93.3 to 93.4%), and AB697895 (95.4 to 97.0%), respectively. Five Russian isolates shared 99.2 to 100% nucleotide sequence identity, depending on the genomic segment. Their sequences were deposited in GenBank under accession numbers MW201216 to MW201230 and MW208662 to MW208676. Phylogenetic analysis of six ORFs showed that ORF1 to ORF3 and ORF6 of the Russian isolates clustered with FMV isolates from Italy while ORF4 grouped with the isolate JTT-Pa (AB697863) from Japan (Fig. S2). ORF5 of the Russian isolates formed a separate cluster with the isolates SB1 and SB2 from Serbia and JTT-Vi from Japan (AB697879 to AB697884). Incongruency of phylogenetic relationship among the genomic segments suggests reassortment among ancestors of the Russian FMV isolates. In addition, similar to the SB1, SB2 and JTT-Vi, ORF5 of the Russian isolates encodes a protein of 486 amino acid (aa) residues in contrast to the corresponding protein of Italian isolates consisting of 502 aa. To the best of our knowledge, this is the first report of FMV in Russia. This finding not only expands the information on the geographical distribution of FMV, but also extends knowledge on F. pseudocarica as a natural host of the virus.

scholarly journals Control Fig Mosaic Virus By plant extracts with salicylic acid

2021 ◽  
Vol 790 (1) ◽  
pp. 012058
Author(s):  
Shrooq Zagier ◽  
Fadhal Al Fadhal ◽  
Osamah Alisawi
Keyword(s):  
Salicylic Acid ◽  
Mosaic Virus ◽  
Plant Extracts ◽  
Fig Mosaic Virus

scholarly journals First report of pea enation mosaic virus 1 infecting Lathyrus ochrus (L.) DC and L. cicera L. in Greece

2021 ◽  
Author(s):  
Kyriaki Sareli ◽  
Konstantinos Gaitanis ◽  
Ioannis T. Tsialtas ◽  
Stephan Winter ◽  
Elisavet K. Chatzivassiliou
Keyword(s):  
Mosaic Virus ◽  
First Report ◽  
Pea Enation Mosaic Virus

scholarly journals First Report of Wisteria vein mosaic virus in Wisteria sinensis in the United States of America

2008 ◽  
Vol 9 (1) ◽  
pp. 42 ◽  
Author(s):  
Rayapati A. Naidu ◽  
Gandhi Karthikeyan
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
United States Of America ◽  
The United States ◽  
Home Gardens ◽  
First Report ◽  
Woody Perennial ◽  
Wisteria Sinensis ◽  
First Time ◽  
Wisteria Vein Mosaic Virus

The ornamental Chinese wisteria (Wisteria sinensis) is a woody perennial grown for its flowering habit in home gardens and landscape settings. In this brief, the occurrence of Wisteria vein mosaic virus (WVMV) was reported for the first time in Chinese wisteria in the United States of America. Accepted for publication 18 June 2008. Published 18 August 2008.

First report of tomato mosaic virus infecting chili pepper (Capsicum annuum L.) in Korea

2021 ◽  
Author(s):  
In-Sook Cho ◽  
Ju-Yeon Yoon ◽  
Eun-Young Yang ◽  
Soo-Young Chae ◽  
Bong Nam Chung ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
Capsicum Annuum ◽  
Chili Pepper ◽  
Tomato Mosaic Virus ◽  
First Report ◽  
Capsicum Annuum L

scholarly journals First report of the infection of alfalfa mosaic virus in Salvia sclarea in Hungary

2018 ◽  
Vol 100 (3) ◽  
pp. 607-607 ◽  
Author(s):  
Pal Salamon ◽  
Anita Sos-Hegedus ◽  
Peter Gyula ◽  
Gyorgy Szittya
Keyword(s):  
Mosaic Virus ◽  
Alfalfa Mosaic Virus ◽  
First Report ◽  
Salvia Sclarea

scholarly journals First Report of Cucumber mosaic virus in Desert Rose in Taiwan

Plant Disease ◽  
2012 ◽  
Vol 96 (4) ◽  
pp. 593-593 ◽  
Author(s):  
Y. K. Chen ◽  
Y. S. Chang ◽  
Y. W. Lin ◽  
M. Y. Wu
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Chenopodium Quinoa ◽  
Rabbit Antiserum ◽  
Serological Tests ◽  
Reading Frame ◽  
First Report ◽  
Reverse Transcription Pcr ◽  
Wilt Virus ◽  
Line Patterns

Desert rose (Adenium obesum (Forssk.) Roem. & Schult, family Apocynaceae) is native to southeastern Africa, and is a perennial potted ornamental with colorful flowers that are popular in Taiwan. Symptoms of mosaic and chlorotic ringspots and line patterns on leaves were observed in July 2010, on all eight plants in a private garden in Potzu, Chiayi, Taiwan. Spherical virus particles with a diameter of approximately 28 nm were observed in crude sap prepared from symptomatic leaves. Virus culture was established by successive local lesion isolation in Chenopodium quinoa and was maintained in the systemic host Nicotiana tabacum van Hicks. The virus was mechanically transmissible to indicator plants and induced symptoms similar to those incited by Cucumber mosaic virus (CMV). Observed symptoms included local lesions on inoculated leaves of C. amaranticolor and systemic mosaic in Cucumis sativus, Lycopersicon esculentum, N. benthamiana, N. glutinosa, and N. rustica. On N. tabacum, necrotic ringspots developed on inoculated leaves followed by systemic mosaic. Serological tests using ELISA assays and western blotting indicated that the virus reacted positively to a rabbit antiserum prepared to CMV (4). Amplicons of an expected size (1.1 kb) were obtained in reverse transcription-PCR with primers specific to the 3′-half of CMV RNA 3 (3) using total RNA extracted from infected desert rose and N. tabacum. The amplified cDNA fragment was cloned and sequenced (GenBank Accession No. AB667971). Nucleotide sequences of the coat protein open reading frame (CP ORF) (657 nt) had 92 to 96% and 76 to 77% sequence identity to those of CMV in subgroups I (GenBank Accession Nos. NC_001440, D00385, M57602, D28780, and AB008777) and II (GenBank Accession Nos. L15336, AF127976, AF198103, and M21464), respectively. Desert roses infected by Tomato spotted wilt virus (TSWV) (1) and CMV (2) have been reported previously. In spite of the plants showing mosaic symptoms similar to that caused by CMV (2) and chlorotic ringspots and line patterns caused by TSWV (1), only CMV was detected in and isolated from these infected desert roses. However, the possibility of mixed infection of CMV and other viruses were not excluded in this research. To our knowledge, this is the first report of CMV infection in desert rose plants occurring in Taiwan. References: (1) S. Adkins and C. A. Baker. Plant Dis. 89:526, 2005. (2) C. A. Baker et al. Plant Dis. 87:1007, 2003. (3) Y. K. Chen et al. Arch. Virol. 146:1631, 2001. (4) Y. K. Chen and C. C. Yang. Plant Dis. 89:529, 2005.

First report of association of Cucumber mosaic virus with blister and leaf distortion of castor bean (Ricinus communis) in India

2010 ◽  
Vol 38 (3) ◽  
pp. 283-289 ◽  
Author(s):  
Shri Krishna Raj ◽  
Sunil Kumar Snehi ◽  
Karmveer Kumar Gautam ◽  
Mohammad Sajid Khan
Keyword(s):  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Castor Bean ◽  
Ricinus Communis ◽  
First Report ◽  
Leaf Distortion
Sign in / Sign up

Export Citation Format

Share Document