scholarly journals Identification of viruses infecting six plum cultivars in Korea by RNA-sequencing

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e9588 ◽  
Author(s):  
Yeonhwa Jo ◽  
Hoseong Choi ◽  
Sen Lian ◽  
Jin Kyong Cho ◽  
Hyosub Chu ◽  
...  
Keyword(s):  
Rna Sequencing ◽  
De Novo ◽  
Reference Database ◽  
Rna Seq ◽  
Rt Pcr ◽  
Virus Identification ◽  
Hop Stunt Viroid ◽  
Chlorotic Leaf ◽  
Peach Trees ◽  
Next Generation Sequencing Ngs

Background Plums are a kind of stone fruit, a category that includes peaches, cherries, apricots, and almonds. In Korea, Japanese plum trees are usually cultivated as they best suit the climate. To date, there have been few studies in Korea on viruses infecting plum trees compared to those infecting peach trees. Methods To identify viruses and viroids infecting plum trees, we collected leaf samples from six different plum cultivars and subjected them to RNA-sequencing (RNA-seq). Six different plum transcriptomes were de novo assembled using the Trinity assembler followed by BLAST searching against a viral reference database. Results We identified hop stunt viroid (HSVd) and six viruses, including apple chlorotic leaf spot virus (ACLSV), little cherry virus-1 (LChV-1), peach virus D (PeVD), peach leaf pitting-associated virus (PLPaV), plum bark necrosis stem pitting-associated virus (PBNSPaV), and prunus necrotic ringspot virus (PNRSV), from six plum cultivars by RNA-seq. RT-PCR confirmed the infection of HSVd and three viruses—ACLSV, PBNSPaV, and PNRSV—in plum trees. However, RT-PCR demonstrated that plum trees in this study were not infected by LChV-1, PeVD, or PLPaV. It is likely that the three viruses LChV-1, PeVD, and PLPaV as identified by RNA-seq were contaminants from other peach libraries caused by index misassignment, which suggests that careful confirmation by other methods should be carried out in next-generation sequencing (NGS)-based virus identification. Taken together, we identified a viroid and three viruses infecting plum trees in Korea.

scholarly journals First Report of Apple chlorotic leaf spot virus in Hawthorn in China

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 164-164 ◽  
Author(s):  
M. Wang ◽  
H. Dai
Keyword(s):  
Leaf Spot ◽  
De Novo ◽  
Genomic Sequence ◽  
Nucleotide Identity ◽  
Rna Seq ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
Chlorotic Leaf ◽  
Rosaceae Family

Apple chlorotic leaf spot virus (ACLSV) is the type species of the genus Trichovirus in the Betaflexiviridae family (1). ACLSV is distributed worldwide in most pome and stone fruit trees of the Rosaceae family, including apple, pear, peach, plum, cherry, apricot, and hawthorn (3). In 2012, a de novo assembly of the fruit transcriptome of a hawthorn (Crataegus pinnatifida) accession maintained in the National Hawthorn Germplasm Repository at Shenyang was conducted using Illumina-based RNA-seq data, and it resulted that a 7,543 nt of the genomic sequence of ACLSV was assembled. To confirm the result of Illumina RNA-Seq analysis, nine pairs of primers were designed according to the assembled sequence of ACLSV to amplify the genomic sequence of ACLSV by RT-PCR with total RNA extracted from hawthorn leaves as template (2). The full-length sequence of the isolate of ACLSV from hawthorn assembled with the sequences of the RT-PCR fragments was also 7,543 nt (GenBank Accession No. KM207212), which shows 99.5% nucleotide identity with the sequence assembled from Illumina RNA-seq data. The isolate of ACLSV from hawthorn was named SY01, which shows about 75% nucleotide identity with the sequences of ACLSV isolated from apple (GenBank Accession No. KJ522693), peach (JN634760), and plum (M58152). The nucleotide sequences of coat protein and RNA polymerase genes of SY01 are about 83 and 88% identical with those of ACLSV isolates in GenBank, respectively. A pair of primers HF/HR (ACCGGCGTCTTTTGCAAACT/TGGGTTCCAGAGTTTGAATGCA), which amplified a 210-bp fragment, was designed according to the sequence of SY01 to detect ACLSV in hawthorns. With RT-PCR, ACLSV was detected in 6 of the 30 accessions of hawthorn, and the nucleotide identity among PCR fragments was 92%. In addition, leaves from six RT-PCR positive plants reacted positively when tested by DAS-ELISA with polyclonal antisera (X-Y Biotechnology, Shanghai, China) raised against ACLSV. These findings, representing the first report of the presence of ACLSV in hawthorn in China, illustrate the need to develop virus-free trees of hawthorn for cultivation and germplasm distribution of this important Rosaceae family plant. References: (1) E. B. Carstens. Arch. Virol. 155:133, 2010. (2) H. Dai et al. PLoS ONE 8(9):e72910, 2013. (3) A. T. Katsiani et al. Plant Pathol. 63:63, 2014.

scholarly journals Multiple Viral Infections Detected in Phytophthora condilina by Total and Small RNA Sequencing

Viruses ◽  
2021 ◽  
Vol 13 (4) ◽  
pp. 620
Author(s):  
Leticia Botella ◽  
Thomas Jung
Keyword(s):  
Rna Sequencing ◽  
Small Rna ◽  
Viral Infections ◽  
De Novo ◽  
Phytophthora Species ◽  
Small Rna Sequencing ◽  
Rna Seq ◽  
Rt Pcr ◽  
Total Rna ◽  
Southern Portugal

Marine oomycetes have recently been shown to be concurrently infected by (−)ssRNA viruses of the order Bunyavirales. In this work, even higher virus variability was found in a single isolate of Phytophthora condilina, a recently described member of Phytophthora phylogenetic Clade 6a, which was isolated from brackish estuarine waters in southern Portugal. Using total and small RNA-seq the full RdRp of 13 different potential novel bunya-like viruses and two complete toti-like viruses were detected. All these viruses were successfully confirmed by reverse transcription polymerase chain reaction (RT-PCR) using total RNA as template, but complementarily one of the toti-like and five of the bunya-like viruses were confirmed when dsRNA was purified for RT-PCR. In our study, total RNA-seq was by far more efficient for de novo assembling of the virus sequencing but small RNA-seq showed higher read numbers for most viruses. Two main populations of small RNAs (21 nts and 25 nts-long) were identified, which were in accordance with other Phytophthora species. To the best of our knowledge, this is the first study using small RNA sequencing to identify viruses in Phytophthora spp.

scholarly journals Recent Applications of RNA Sequencing in Food and Agriculture

2021 ◽  
Author(s):  
Venkateswara R. Sripathi ◽  
Varsha C. Anche ◽  
Zachary B. Gossett ◽  
Lloyd T. Walker
Keyword(s):  
Rna Sequencing ◽  
Alternative Polyadenylation ◽  
Cost Effective ◽  
Circular Rnas ◽  
Rna Seq ◽  
Complete Collection ◽  
Specific Expression ◽  
Food And Agriculture ◽  
Allele Specific ◽  
Next Generation Sequencing Ngs

RNA sequencing (RNA-Seq) is the leading, routine, high-throughput, and cost-effective next-generation sequencing (NGS) approach for mapping and quantifying transcriptomes, and determining the transcriptional structure. The transcriptome is a complete collection of transcripts found in a cell or tissue or organism at a given time point or specific developmental or environmental or physiological condition. The emergence and evolution of RNA-Seq chemistries have changed the landscape and the pace of transcriptome research in life sciences over a decade. This chapter introduces RNA-Seq and surveys its recent food and agriculture applications, ranging from differential gene expression, variants calling and detection, allele-specific expression, alternative splicing, alternative polyadenylation site usage, microRNA profiling, circular RNAs, single-cell RNA-Seq, metatranscriptomics, and systems biology. A few popular RNA-Seq databases and analysis tools are also presented for each application. We began to witness the broader impacts of RNA-Seq in addressing complex biological questions in food and agriculture.

scholarly journals MAJIQ-SPEL: Web-Tool to interrogate classical and complex splicing variations from RNA-Seq data

2017 ◽  
Author(s):  
Christopher J. Green ◽  
Matthew R. Gazzara ◽  
Yoseph Barash
Keyword(s):  
Alternative Splicing ◽  
Rna Sequencing ◽  
Experimental Validation ◽  
Ucsc Genome Browser ◽  
Rna Seq ◽  
Web Tool ◽  
Rt Pcr ◽  
Design Algorithm ◽  
Gene Isoforms ◽  
Downstream Analysis

AbstractAnalysis of RNA sequencing (RNA-Seq) data have highlighted the fact that most genes undergo alternative splicing (AS) and that these patterns are tightly regulated. Many of these events are complex, resulting in numerous possible isoforms that quickly become difficult to visualize, interpret, and experimentally validate. To address these challenges, We developed MAJIQ-SPEL, a web-tool that takes as input local splicing variations (LSVs) quantified from RNA-Seq data and provides users with visualization and quantification of gene isoforms associated with those. Importantly, MAJIQ-SPEL is able to handle both classical (binary) and complex (non-binary) splicing variations. Using a matching primer design algorithm it also suggests users possible primers for experimental validation by RT-PCR and displays those, along with the matching protein domains affected by the LSV, on UCSC Genome Browser for further downstream analysis.Availability: Program and code will be available at http://majiq.biociphers.org/majiq-spel

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

scholarly journals Peach latent mosaic viroid Detected for the First Time on Almond Trees in Tunisia

Plant Disease ◽  
2005 ◽  
Vol 89 (11) ◽  
pp. 1244-1244 ◽  
Author(s):  
I. Fekih Hassen ◽  
S. Roussel ◽  
J. Kummert ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Fruit Trees ◽  
Mediterranean Area ◽  
Prunus Dulcis ◽  
Pcr Analysis ◽  
Rt Pcr ◽  
New Host ◽  
Hop Stunt Viroid ◽  
Almond Trees ◽  
Plant Pathol ◽  
Peach Trees

Almond (Prunus dulcis Mill) is an important crop in countries of the Mediterranean area. Until now, among viroids, only Hop stunt viroid (HSVd) is known to infect cultivated almond trees (2). In 2004, a survey of almond trees was carried out in orchards in different regions of Tunisia, a major producing and exporting country of almond. Symptoms such as mosaic and necrotic lesions, potentially caused by the Peach latent mosaic viroid (PLMVd), were observed on leaves of cultivated almond trees. Since PLMVd was recently detected in peach and pear trees in Tunisia (4), the presence of this viroid in almond trees was studied. The detection method on the basis of one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays was previously described and validated for the detection of this viroid in fruit trees (4). Amplification products were obtained by using previously reported primer pairs of PLMVd (1). Positive controls included RNA preparations of twigs of PLMVd-infected GF 305 peach seedlings. These materials, provided by B. Pradier (Station de Quarantaine des Ligneux, Lempdes, France), were positive as revealed by chip budding on peach seedling indicator plants grown under greenhouse conditions. RT-PCR analysis of nucleic acid preparations from leaves of almond showed specific amplification products with the expected size of 337 bp for two almond trees among 17 trees tested. Nucleotide sequence analyses of cloned amplification products obtained with the PLMVd primers confirmed a size of 337 bp and revealed a sequence similar to sequences from other PLMVd isolates previously characterized. The sequences shared 94 to 98% identity with the reference isolates of PLMVd from peach (EMBL Accession No. M83545, AF170511, AF170514, and AY685181). The two infected almond trees are proximal to each other and peach trees infected with PLMVd. This suggests that one tree may have served as a source of inoculum for the other through agronomic practices such as pruning or the aphid Myzus percicae (3). Alternatively, PLMVd may have originated in an unknown host and was then transmitted to almond trees. Our investigation shows that almond is a new host for PLMVd. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañizares et al. Eur. J. Plant Pathol. 105:553, 1999. (3) J. C. Desvignes et al. Phytoma 444:70, 1992. (4) I. Fekih Hassen et al. Plant Dis. 88:1164, 2004.

scholarly journals Integument transcriptome profile of the European sea cucumber Holothuria forskali (Holothuroidea, Echinodermata)

2021 ◽  
Author(s):  
Jérôme Delroisse ◽  
Marie Bonneel ◽  
Mélanie Demeuldre ◽  
Igor Eeckhaut ◽  
Patrick Flammang
Keyword(s):  
Sea Cucumber ◽  
De Novo ◽  
Model Organisms ◽  
Rna Seq ◽  
Illumina Hiseq ◽  
Purple Sea Urchin ◽  
New Genes ◽  
Illumina Hiseq Sequencing ◽  
Reference Databases ◽  
Next Generation Sequencing Ngs

AbstractIn non-model organisms, Next Generation Sequencing (NGS) technology improve our ability to analyze gene expression and identify new genes or transcripts of interest. In this research, paired-end Illumina HiSeq sequencing has been used to describe a composite transcriptome based on two libraries generated from dorsal and ventral integuments of the European sea cucumber Holothuria forskali (Holothuroidea, Echinodermata). A total of 43,044,977 million HQ reads were initially generated. After de novo assembly, a total of 111,194 unigenes were predicted. On all predicted unigenes, 32,569 show significant matches with genes/proteins present in the reference databases. Around 50% of annotated unigenes were significantly similar to sequences from the purple sea urchin Strongylocentrotus purpuratus genome. Annotation analyses were performed on predicted unigenes using public reference databases. These RNA-seq data provide an interesting resource for researchers with a broad interest in sea cucumber biology.

scholarly journals Loss of Gene Information: Discrepancies between RNA Sequencing, cDNA Microarray, and qRT-PCR

2021 ◽  
Vol 22 (17) ◽  
pp. 9349
Author(s):  
Nicole Rachinger ◽  
Stefan Fischer ◽  
Ines Böhme ◽  
Lisa Linck-Paulus ◽  
Silke Kuphal ◽  
...  
Keyword(s):  
Gene Expression ◽  
Rna Sequencing ◽  
Expression Profiles ◽  
Cdna Array ◽  
Gene Expression Profiles ◽  
Strong Impact ◽  
Rna Seq ◽  
Rt Pcr ◽  
Gene Information ◽  
Insight Into

Molecular analyses of normal and diseased cells give insight into changes in gene expression and help in understanding the background of pathophysiological processes. Years after cDNA microarrays were established in research, RNA sequencing (RNA-seq) became a key method of quantitatively measuring the transcriptome. In this study, we compared the detection of genes by each of the transcriptome analysis methods: cDNA array, quantitative RT-PCR, and RNA-seq. As expected, we found differences in the gene expression profiles of the aforementioned techniques. Here, we present selected genes that exemplarily demonstrate the observed differences and calculations to reveal that a strong RNA secondary structure, as well as sample preparation, can affect RNA-seq. In summary, this study addresses an important issue with a strong impact on gene expression analysis in general. Therefore, we suggest that these findings need to be considered when dealing with data from transcriptome analyses.

scholarly journals First Report of Peach latent mosaic viroid in Peach Trees in Montenegro

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 150-150 ◽  
Author(s):  
I. Mavric Pleško ◽  
M. Viršcek Marn ◽  
Z. Miladinovic ◽  
J. Zindovic
Keyword(s):  
Prunus Persica ◽  
Stone Fruit ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
First Report ◽  
Fruit Species ◽  
Hop Stunt Viroid ◽  
Viroid Infection ◽  
Fruit Samples ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to infect stone fruit species worldwide. The viroid infection can be latent or induce a variety of disease symptoms. Stone fruit samples were collected in Montenegro for a Plum pox virus (PPV) survey in 2007. Thirteen samples infected with PPV, taken from 12-year-old peach trees (Prunus persica (L.) Batsch, cv. Elegant Lady) in the area of Cemovsko field, were tested for the presence of PLMVd and HSVd by reverse transcription (RT)-PCR. Mild or severe mosaic, chlorotic rings, and fruit deformations were observed on some trees. Total RNA was extracted from all samples with a RNeasy Plant Mini Kit (Qiagen, Chatsworth, CA) and RT-PCR was performed. Samples were tested for HSVd and PLMVd infection using primer pairs RF-43/RF-44 for PLMVd (1) and VP-19/VP-20 for HSVd (2). Amplification products of approximately 348 bp were obtained from nine samples with PLMVd primers. Amplification products from seven samples were successfully cloned into pGEM-T Easy Vector (Promega, Madison, WI) and used for transformation of Escherichia coli. At least four clones of each sample were sequenced. Obtained sequences were 337 and 338 nucleotides long and shared 90.3 to 100% identity. Consensus sequences of each sample were deposited in GenBank under Accession Nos. JF927892–JF927898. They showed 92.6 to 97.9% identity among each other, 94 to 98% identity with the PLMVd isolate G sequence (Accession No. EF591868) and 91.8 to 94.4% identity with PLMVd sequence M83545. HSVd was not detected in analyzed samples. PLMVd infections were found on peach trees in an area where approximately 40% of the peach production is located. Therefore, PLMVd infections can pose a threat to peach production in Montenegro. To our knowledge this is the first report of PLMVd infection of peach in Montenegro. References: (1) S. Ambrós et al. J. Virol. 72:7397, 1998. (2) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997.

scholarly journals Rare Variant Phasing and Haplotypic Expression from RNA-Sequencing with phASER

2016 ◽  
Author(s):  
Stephane E. Castel ◽  
Pejman Mohammadi ◽  
Wendy K. Chung ◽  
Yufeng Shen ◽  
Tuuli Lappalainen
Keyword(s):  
Rna Sequencing ◽  
De Novo ◽  
Genomic Analysis ◽  
Population Based ◽  
Rna Seq ◽  
High Confidence ◽  
Population Genetic Analysis ◽  
Haplotype Phasing ◽  
Functional Genomic Analysis ◽  
Expression Studies

Haplotype phasing of genetic variants is important for clinical interpretation of the genome, population genetic analysis, and functional genomic analysis of allelic activity. Here we present phASER, a fast and accurate approach for phasing variants that are overlapped by sequencing reads, including those from RNA-sequencing (RNA-seq), which often span multiple exons due to splicing. This provides 1) dramatically more accurate phasing of rare and de novo variants compared to population-based phasing; 2) phasing of variants in the same gene up to hundreds of kilobases away which cannot be obtained from DNA-sequencing reads; 3) high confidence measures of haplotypic expression, greatly improving power for allelic expression studies.

Sign in / Sign up

Export Citation Format

Share Document