scholarly journals Molecular characterization and phylogenetic analysis of a Squash leaf curl virus isolate from Baja California Sur, Mexico

PeerJ ◽  
2019 ◽  
Vol 7 ◽  
pp. e6774
Author(s):  
Diana Medina-Hernández ◽  
M. Goretty Caamal-Chan ◽  
Mayela Vargas-Salinas ◽  
Abraham Loera-Muro ◽  
Aarón Barraza ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Middle East ◽  
Baja California ◽  
Rolling Circle Amplification ◽  
Evolutionary Relationship ◽  
Baja California Sur ◽  
La Paz ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

Background The begomovirus, squash leaf curl virus (SLCuV) is one of the causal agents of squash leaf curl (SLC) disease, which is among the most destructive diseases of cucurbit crops in tropical, subtropical, and semiarid regions worldwide. This disease was originally reported in the American continent with subsequent spread to the Mediterranean basin. Up to now, SLCuV has only been detected by PCR in Mexico. This study provides the first complete sequence of a Mexican SLCuV isolate from Baja California Sur (BCS). In addition, the genome of the virus was characterized, establishing its phylogenetic relationship with other SLCuV isolates. Methods The full genome (DNA-A and DNA-B) was amplified by rolling circle amplification, cloned and sequenced and the open reading frames (ORF) were annotated. Virus identification was performed according to the International Committee on Taxonomy of Viruses (ICTV) criteria for begomovirus species demarcation. To infer evolutionary relationship with other SLCuV isolates, phylogenetic and recombination analyses were performed. Results The SLCuV-[MX-BCS-La Paz-16] genome (DNA-A and DNA-B) had 99% identity with SLCuV reference genomes. The phylogenetic analysis showed that SLCuV-[MX-BCS-La Paz-16] is closely related to SLCuV isolates from the Middle East (Egypt, Israel, Palestine and Lebanon). No evidence of interspecific recombination was determined and iterons were 100% identical in all isolates in the SLCuV clade. Conclusions SLCuV-[MX-BCS-La Paz-16] showed low genetic variability in its genome, which could be due to a local adaptation process (isolate environment), suggesting that SLCuV isolates from the Middle East could have derived from the southwestern United States of America (USA) and northwestern Mexico.

scholarly journals Cucurbit leaf crumple virus (CuLCrV) associated to watermelon disease in Campeche state, Mexico

Plant Disease ◽  
2020 ◽  
Author(s):  
Edgar Antonio Rodríguez-Negrete ◽  
Rafael Jordan-Ramírez ◽  
Norma Elena Leyva-López ◽  
Jesus Mendez-Lozano
Keyword(s):  
Citrullus Lanatus ◽  
Infectious Clone ◽  
Rolling Circle Amplification ◽  
Yield Reduction ◽  
Specific Primers ◽  
Genebank Accession ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Cucurbit Leaf Crumple Virus ◽  
Leaf Curl

An annual recurrent disease causing yield reduction in cultivated watermelon (Citrullus lanatus) was documented by the growers in different farms of Campeche state, Mexico. In April 2019 and March 2020 open field grown watermelon plants showed symptoms such as leaf curling, crumpling, and leaf basal or apical necrosis (Figure S1), with an incidence ranging from 30 up to 80%. These plants also presented high populations of whitefly, especially in the most affected fields. In order to identify the causal agent of the disease, a total of 22 symptomatic watermelon plants were collected in four locations from Campeche state. Total nucleic acids (DNA and RNA) were extracted from these leaf samples. Initially, RT-PCR analysis was performed with specific primers (Table S1) for cucurbit-infecting Crinivirus transmitted by whitefly but the expected size PCR product for those viruses was not amplified in any of these samples. To investigate the presence of cucurbit-infecting begomoviruses, PCR was performed by using specific primers for those begomoviruses reported in Mexico and north/central America including Squash leaf curl virus (SLCV), Watermelon chlorotic stunt virus (WmCSV), Melon chlorotic leaf curl virus (MCLCuV), and Cucurbit leaf crumple virus (CuLCrV) (Table S1). Only the expected amplicon size of ~1089 bp for CuLCrV was amplified from DNA extracts from all 22 watermelon samples, suggesting a single cucurbit-associated virus. The putative complete genome of the CuLCrV Campeche isolate was amplified by circular DNA enrichment using a Rolling Circle Amplification (RCA) procedure from two representative samples, followed by enzymatic digestion using BamHI, EcoRI, KpnI, and SacI enzymes (Inoue-Nagata et al., 2004). Expected linearized full-length viral components (~2.7 kb) were obtained with EcoRI and SacI, and both products, from one selected sample, were cloned in to pGreen0029 vector and were fully sequenced. Sequence analysis of the EcoRI clone, designated as LV2019Camp_A (deposited in GenBank accession no. MW273384) revealed the highest identity of 97.52% to CuLCrV DNA-A isolate Baja California Sur isolate (GeneBank accession no. MN625831.1), whereas the KpnI clone, designated as LV2019Camp_B (deposited in GenBank accession no. MW273385), shared 94.87% identity with DNA B of CuLCrV isolate Arizona (GeneBank accession no. AF327559.1). Subsequently, CuLCrV isolate Campeche-derived agroinfectious clone, was obtained by constructing a partial dimeric tandem repeat of both DNA-A and DNA-B components (Bang et al., 2014). Twelve watermelon plants were agroinfiltrated with the infectious clone at the fourth true leaf stage, resulting in symptomatic plants (11/12) exhibiting leaf yellowing, curling, and crumpling 15 days after agroinfiltrated (Figure S1), and CuLCrV infection was confirmed by PCR specific detection using DNA extract from non-inoculated leaves. Previously CuLCrV has been detected in the USA (Arizona, Texas, California, Florida, South Carolina, and Georgia), and north Mexico (Coahuila) infecting cucurbits including squash, cucumber, cantaloupe, pumpkin, and watermelon (Brown et al., 2000., Keinath et al., 2018), in both single and mixed infection with other whitefly transmitted RNA viruses (CYSDV, genera Crinivirus), and DNA viruses (SLCV, genera Begomovirus) (Kuo et al., 2007). To our knowledge, this is the first report of CuLCrV infecting a cucurbit crop in the Campeche state from the Yucatán peninsula, in Mexico.

scholarly journals First Report of Tomato yellow leaf curl virus Co-infecting Pepper with Tomato chino La Paz virus in Baja California Sur, Mexico

Plant Disease ◽  
2010 ◽  
Vol 94 (10) ◽  
pp. 1266-1266 ◽  
Author(s):  
Y. Cardenas-Conejo ◽  
G. Arguello-Astorga ◽  
A. Poghosyan ◽  
J. Hernandez-Gonzalez ◽  
V. Lebsky ◽  
...  
Keyword(s):  
Restriction Fragment ◽  
Baja California ◽  
Tomato Yellow Leaf ◽  
The State ◽  
Yellow Leaf ◽  
Baja California Sur ◽  
La Paz ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Test Plants

Chile peppers are among the most common and important crops in the State of Baja California Sur, Mexico, where diverse varieties of this crop are annually cultivated. The “chile ancho” (Capsicum annuum L. var. ancho poblano) is one of the most popular hot peppers that is exported fresh to the United States. During a survey in December of 2007 in an experimental field of the CIBNOR in El Carrizal, one of the principal farm districts in the state, a high incidence of yellowing, stunted growth with shortened internodes, foliage discoloration, malformation and crinkle, abortion of flowers, and reduction in size and quantity of fruit were noted in chile ancho. Symptoms and the presence of large populations of whiteflies in the field suggested a possible viral etiology of disease. The symptoms of disease were successfully transmitted by grafting from field plants to tomato and pepper test plants. Samples from both field and test plants were analyzed by scanning electron microscopy (SEM) and molecular techniques. SEM study revealed groups of geminate particles characteristic of begomoviruses (Geminiviridae) in phloem tissue of randomly selected symptomatic plants (four field and two test plants). Total DNA from 12 symptomatic plants (eight naturally infected and four test plants) was obtained by a modified Dellaporta method and analyzed by PCR using the begomovirus universal primers prRepDGR (2) and prC889 (3). Amplicons of ~1.4 kb were obtained from all plant samples and PCR products from four of them were cloned into pGEM-T Easy vector (Promega, Madison, WI) and subsequently analyzed by restriction fragment length polymorphism (RFLP) using EcoRI and HinfI. Two distinct restriction fragment patterns were observed among the cloned PCR products, indicating the occurrence of at least two viruses in the infected plant tissues. The four examined samples contained the same two begomoviruses according to the RFLP analysis data. The complete sequence of the genomic component A of those viruses was determined by PCR amplification of viral DNA with universal, degenerate primers previously described (2), the subsequent cloning of overlapped PCR products, and sequencing. The full-length DNA-A sequence was assembled and compared with viral sequences available at the GenBank database using BlastN and the ClustalV alignment method (MegAlign; DNASTAR, Madison, WI). The 2,781-bp complete genome sequence of one co-infecting monopartite begomovirus (Accession No. HM459851) displayed the highest identity (99%) with Tomato yellow leaf curl virus (TYLCV), isolate Guasave, Sinaloa (Accession No. FJ609655). The 2,609-bp DNA-A sequence of the second begomovirus exhibited the highest nucleotide identity (96%) with Tomato chino La Paz virus (ToChLPV)-[Baja California Sur] (Accession No. AY339619). The presence of TYLCV in this region of Mexico had not been previously reported nor was ToChLPV detected in pepper until now. To our knowledge, this is the first report of a mixed infection of pepper plants with TYLCV and a bipartite begomovirus in Baja California Peninsula. Since the high frequency of recombination events observed in begomovirus mixed infections involving TYLCV (1), it would be important to monitor the possible emergence of ToChLPV-TYLCV recombinants with higher potential virulence. References: (1) S. García-Andrés et al. Virology 365:210, 2007. (2) A. Mauricio-Castillo et al. Plant Dis. 91:1513, 2007. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals A New Strain of Tomato chino La Paz virus Associated with a Leaf Curl Disease of Tomato in Baja California Sur, Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (7) ◽  
pp. 973-973 ◽  
Author(s):  
R. J. Holguín-Peña ◽  
G. R. Arguello-Astorga ◽  
J. K. Brown ◽  
R. F. Rivera-Bustamante
Keyword(s):  
Restriction Fragment ◽  
Baja California ◽  
Sequence Similarity ◽  
Polymorphism Analysis ◽  
Virus Species ◽  
Baja California Sur ◽  
La Paz ◽  
Tomato Plants ◽  
Severe Leaf ◽  
Leaf Curl

Since 2001, geminivirus-like disease symptoms have been observed in tomato plants on the Baja California Peninsula of Mexico. These diseases have been associated with large populations of Bemisia tabaci (Genn.) in commercial fields and have caused dramatic decreases in expected yields. Leaf samples from tomato plants displaying symptoms of stunting and severe upward leaf curling were collected in March 2002 in fields located near the city of La Paz, Baja California Sur (BCS). Total DNA was extracted and tested for the presence of geminiviral DNA using polymerase chain reaction (PCR) with begomovirus-specific degenerate primer pairs PALIv1978/PARIc494 and PALIc1978/PARIv494 (4). PCR products of the expected size (~1.16 and ~1.45 kb) were obtained, cloned into pGEM-T Easy (Promega, Madison, WI), and sequenced. Restriction fragment length polymorphism analysis of the PCR fragments was performed using EcoRI, HindIII, PstI, and XbaI. Restriction fragment patterns were the same for all amplicons and no evidence of mixed infection was obtained. In addition, experimental transmission by whiteflies and inoculations by biolistics consistently induced severe leaf epinasty and stunted growth on tomato seedlings. The complete (2,606 nt) DNA-A sequence of the infecting virus was determined (GenBank Accession No. AY339618) and compared with viral sequences available at GenBank-EMBL databases using BLASTN and the CLUSTAL program (MegAlign, DNASTAR, Madison, WI). The highest nucleotide identity was obtained with the recently described Tomato chino Baja California virus, ToChBCV (90.2%, GenBank Accession No. AY339619), isolated from tomato plantings in El Carrizal, BCS, 100 km from La Paz (3). The second and third best scores were obtained with Tomato severe leaf curl virus from Nicaragua (ToSLCV-NI, 79.6%, GenBank Accession No. AJ508784) and Guatemala (ToSLCV-GT94, 73.8%, GenBank Accession No. AF130415), respectively. Overall, sequence similarity with other New World begomoviruses was rather low (less than 70% identity). Careful analysis of differences between the La Paz isolate and its closest relative, ToChBCV from El Carrizal, revealed that they display different Ori-associated iterons (i.e., replication (Rep)-binding sites) having GGAGTA and GGGTCY core sequences, respectively (1). Moreover, sequence comparisons of the Rep-binding domain (aa 1–120) showed that these domains are only 71% identical. Current taxonomic criteria for begomoviruses establishes that a virus DNA-A sequence identity below 89% with its closest relative is indicative of a separate species (2). Since the La Paz and El Carrizal isolates share 90.2% nt identity, they should be considered strains of a same virus species, recently renamed Tomato chino La Paz virus, ToChLPV (2). Nevertheless, the remarkable differences in their putative replication specificity determinants suggest that ToChLPV and ToChLPV-[BCS] could be incompatible in replication, an interesting issue that should be experimentally addressed. References: (1) G. R. Arguello-Astorga et al. Virology 203:90, 1994. (2) C. Fauquet and J. Stanley. Arch. Virol. 150:2151, 2005. (3) R. J. Holguín-Peña et al. Plant Dis. 89:341, 2005. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Occurrence and geographic distribution of Squash leaf curl virus in the Baja California Peninsula, Mexico

2019 ◽  
Vol 42 (1) ◽  
pp. 107-115
Author(s):  
Mayela Vargas-Salinas ◽  
Diana Medina-Hernández ◽  
Omar Aranda-López ◽  
Ricardo Hernández-Barrera ◽  
Ramón Jaime Holguín-Peña
Keyword(s):  
Geographic Distribution ◽  
Baja California ◽  
Baja California Peninsula ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report of Squash leaf curl virus in Cucurbits in Lebanon

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1231-1231 ◽  
Author(s):  
H. Sobh ◽  
J. Samsatly ◽  
M. Jawhari ◽  
C. Najjar ◽  
A. Haidar ◽  
...  
Keyword(s):  
Citrullus Lanatus ◽  
Rolling Circle Amplification ◽  
Nucleotide Identity ◽  
Small Scale ◽  
Degenerate Primers ◽  
Squash Leaf Curl Virus ◽  
Pcr Assays ◽  
Leaf Curl Virus ◽  
Severe Leaf ◽  
Leaf Curl

During the second squash cropping season, which coincides with high whitefly populations, a high incidence of plants with severe leaf curl symptoms was observed. Many farmers reported yield losses ranging from 70 to 80%. Surveys were conducted over five cropping seasons (2008 to 2010) and covered the coastal areas of Lebanon. A total of 675 samples were collected, including cucumber (Cucumis sativus), squash (Cucurbita sp.), melon (Cucumis melo), and watermelon (Citrullus lanatus). All squash samples had leaf curl symptoms, whereas 75 to 85% of cucumber, melon, and watermelon samples showed yellowing symptoms. The remaining 15 to 25% were asymptomatic. Total nucleic acids were extracted according to a small-scale CTAB protocol (4). PCR assays were initially conducted using the universal degenerate primers PAL1v1978 and PAR1c496, designed to detect DNA-A of several begomoviruses (3). Following sequencing of 22 randomly selected amplicons, BLASTN analysis showed that 19 samples were infected with Squash leaf curl virus (SLCV). SLCV specific primers: (SqA1R: 5′AGCTGTATCTTGGGCAACAGA3′ and SqA2F: 5′TATCTCCCATCTTGGCAAGG3′; amplicon size: 601 bp) were used for detection in the 675 samples. SLCV was detected in 223/249 (89%), 83/145 (57%), 129/229 (56%), and 25/52 (48%) of squash, cucumber, melon, and watermelon samples, respectively. The SLCV genome from a symptomatic squash plant collected from Akkar, North Lebanon, was amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). The product was used for biolistic inoculation of squash and cucumber as described (2). Severe leaf curl symptoms were observed on 7/10 of the squash seedlings (cv. Camelia F1) within 2 weeks of inoculation. However, no symptoms were observed on cucumber (cv. Beit alpha) 1 month after inoculation, even though 6/11 (54%) of the plants were positive for SLCV in PCR assays. Several primer sets were used for sequencing the full SLCV genome using the RCA product as template. The sequences were submitted to GenBank under accession numbers HM368373 and HM368374 (SLCV DNA A and B, respectively). Phylogenetic analysis showed that SLCV DNA A was most closely related to SLCV isolates from Egypt (DQ285019) and Israel (HQ184436) with 99% nucleotide identity; SLCV DNA B was most closely related to the same SLCV isolate from Israel (HQ184437) with 99% nucleotide identity. SLCV was first observed on squash in California in 1977, but was introduced during the last decade to the Mediterranean region (1) and currently is widespread all over Lebanon, posing a great threat to squash production. References: (1) Antignus et al. Phytoparasitica 31:415, 2003. (2) Guenoune-Gelbart et al. J. Virol. Methods 168:87, 2010. (3) Rojas et al. Plant Dis. 77:340, 1993. (4) Zhang et al. J. Virol. Methods 71:45, 1998.

Género, institucionalismo y marginalidad: la gestión del agua de uso doméstico como desafío para el empoderamiento de las mujeres. El caso de la ciudad de La Paz, Baja California Sur, México

2018 ◽  
pp. 175-199
Author(s):  
Lorella Castorena Davis ◽  
Arely Madai Martínez Valencia
Keyword(s):  
Baja California ◽  
Baja California Sur ◽  
La Paz ◽  
Las Mujeres

El objetivo de este artículo es analizar la persistencia de la división tradicional del trabajo doméstico. La escasa valoración de las actividades de reproducción de la vida, como la maternidad, y el cuidado y atención a otras personas, sumada a condiciones de marginalidad, derivan en un incremento de las cargas de trabajo y reducen las probabilidades de empoderamiento de las mujeres. Asimismo la mala distribución de recursos como el agua, junto con su escasez y deficiente calidad, se tornan en obstáculos para alcanzar la igualdad de género. El vínculo teórico entre género, institucionalismo y marginalidad, así como la selección del caso de estudio, representan los aportes más relevantes de este trabajo, en tanto permiten mostrar el impacto que el funcionamiento de la institución encargada de la distribución del agua tiene sobre las mujeres, en la medida que refuerza el hábito y la norma cultural que las responsabiliza de resolver el abasto de agua al interior de sus hogares. Se analiza la problemática de género que enfrentan mujeres jefas de familia respecto al agua de uso doméstico en cinco colonias marginadas de la ciudad de La Paz, en las que se aplicó un total de 42 cuestionarios gracias a los cuales se concluyó que las mujeres jefas de hogares marginados además de la sobrecarga de trabajo doméstico y de cuidados derivados del abasto insuficiente y deficiente de agua que provee el organismo operador, deben enfrentar los costos derivados tanto del conjunto de diligencias cotidianas que realizan para garantizar que el agua que reciben alcance para satisfacer sus necesidades mínimas, como del gasto que representa el consumo de agua embotellada proveniente de las plantas purificadoras locales o de barrio.

scholarly journals Characterization of a Synergistic Interaction Between Two Cucurbit-Infecting Begomoviruses: Squash leaf curl virus and Watermelon chlorotic stunt virus

2011 ◽  
Vol 101 (2) ◽  
pp. 281-289 ◽  
Author(s):  
Tali Sufrin-Ringwald ◽  
Moshe Lapidot
Keyword(s):  
Eastern Mediterranean ◽  
Dual Infection ◽  
Synergistic Interaction ◽  
Bipartite Begomoviruses ◽  
Disease Symptoms ◽  
Squash Leaf Curl Virus ◽  
Effect On Yield ◽  
Leaf Curl Virus ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Squash leaf curl virus (SLCV) and Watermelon chlorotic stunt virus (WmCSV) are cucurbit-infecting bipartite begomoviruses. Both viruses are found in the eastern Mediterranean basin but the effects of dual infection of both viruses on melon (Cucumis melo L.) have not been described. ‘Arava’ melon plants were inoculated in the greenhouse, using whiteflies, with either SLCV, WmCSV, or both. Control plants were exposed to nonviruliferous whiteflies or not exposed at all. Following inoculation, plants were transplanted to a 50-mesh insect-proof nethouse and grown until fruit maturity. The experiment was performed in two melon-growing seasons: spring, transplant in May and harvest in July; and summer, transplant in August and harvest in October. Following inoculation, SLCV-infected melon plants showed mild symptoms that disappeared with time, and there was no effect on plant height. WmCSV-infected plants developed disease symptoms that became more obvious with time, and plants were somewhat shorter than control plants in the spring but not in the summer. SLCV had no effect on yield, regardless of season. WmCSV had no statistically significant effect on yield in the spring but, in the summer, reduced yield by 22%, on average. Dual-inoculated plants showed a synergistic interaction between the two viruses. They developed disease symptoms that were more pronounced than WmCSV alone, with plants being shorter than control plants by 20 to 25% regardless of season. Moreover, the yield of dual-inoculated plants was reduced on average by 21% in the spring and 54% in the summer, and fruit appearance was adversely affected. Dual inoculation did not affect WmCSV DNA level but SLCV DNA level was increased several-fold by the presence of WmCSV.

scholarly journals Cucurbit leaf curl virus, a New Whitefly Transmitted Geminivirus in Arizona, Texas, and Mexico

Plant Disease ◽  
2000 ◽  
Vol 84 (7) ◽  
pp. 809-809 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris ◽  
M. W. Olsen ◽  
M. E. Miller ◽  
T. Isakeit ◽  
...  
Keyword(s):  
Binding Site ◽  
Field Isolate ◽  
Bipartite Begomovirus ◽  
Degenerate Primers ◽  
Field Isolates ◽  
Squash Leaf Curl Virus ◽  
Cp Gene ◽  
Honeydew Melon ◽  
Leaf Curl Virus ◽  
Leaf Curl

In 1998 to 1999, geminivirus-like symptoms were observed in whitefly-infested pumpkin, honeydew melon, and muskmelon in Arizona and Texas and in Coahuilla, Mexico (MX), respectively. Plants exhibited leaf curl and/or mottling, reminiscent of symptoms caused by Squash leaf curl virus (SLCV-WAZ) described from Arizona in 1981 (2). The isolate from Arizona pumpkin fields was experimentally transmitted to pumpkin seedlings by the “B type” of Bemisia tabaci (Genn.), and symptoms were indistinguishable from those observed in infected fields. Samples from AZ, MX, and TX were assessed for begomovirus presence by polymerase chain reaction (PCR) using degenerate primers that amplify a contiguous fragment containing the viral coat protein (Cp) gene and common region (CR) of the A component (CR-A) (~2,100 bp) and a fragment containing the CR of the B component (CR-B) (~1,100 bp). One to four isolates from each location were examined by PCR using both primer pairs, and at least three amplicons per isolate were cloned and their sequences determined. Alignment of viral Cp nucleotide (nt) sequences revealed that AZ [AF256199], MX, and TX field isolates shared 98.7 to 100% sequence identity, but were only 84.5 to 85.6% identical to the Cp gene of SLCV-extended (SLCV-E) [M38183] and SLCV-restricted (SLCV-R) (S. G. Lazarowitz, unpublished), respectively, suggesting a new, previously undescribed begomoviral species (3). Further, the Cp nt sequence of the three field isolates was 6 nt shorter than SLCV-E, SLCV-WAZ [AF256203], and SLCV-R Cp sequences. The CR-A [AF256200] and CR-B [AF256201] sequences (179 nt, each) of field isolates, including the theoretical Rep binding element, GGTGT, were 100% identical. Although the Rep binding site is identical among field isolates, SLCV-E, SLCV-R, and SLCV-WAZ, the field isolate CR sequence shared only 64.2, 67.5, and 66.9% overall identity with CR-A SLCV-E, SLCV-R [M63155], and SLCV-WAZ [AF256202], respectively. Prior to 1998 to 1999, SLCV-WAZ was the only New World begomovirus of cucurbits known to infect both melon (Cucumis) and pumpkin (Cucurbita) (1). Therefore, SLCV was initially suspected as the causal agent. However, here we provide evidence for a new, previously undescribed bipartite begomovirus of cucurbits in AZ, MX, and TX that is herein provisionally designated Cucurbit leaf curl virus (CuLCV). Prediction of its closest begomovirus relatives by Cp nt sequence and Rep binding site comparisons suggest that CuLCV is a new member of the SLCV lineage, also containing Bean calico mosaic virus, Cabbage leaf curl virus, SLCV-E, and Texas pepper virus-TAM. References: (1) J. K. Brown and M. R. Nelson. Phytopathology 74:1136, 1984. (2) J. K. Brown and M. R. Nelson. Ann. Appl. Biol. 115:243, 1986. (3) M. A. Mayo and C. R. Pringle. J. Gen. Virol. 97:649, 1998.

Sign in / Sign up

Export Citation Format

Share Document