scholarly journals First record of entomopathogenic fungus Entomophaga aulicae in the populations of browntail moth in Bosnia and Herzegovina

2019 ◽  
pp. 59-63
Author(s):  
Mara Tabaković-Tošić ◽  
Marija Milosavljević ◽  
Sanja Jovanović ◽  
Radovan Lučić
Keyword(s):  
Bosnia And Herzegovina ◽  
Entomopathogenic Fungus ◽  
Structural Characteristics ◽  
Microbial Control ◽  
First Record ◽  
Life Forms ◽  
Control Agent ◽  
Resting Spores ◽  
Hyphal Bodies ◽  
The Republic

Browntail moth, is a well-known pest of broadleaf forests of Bosnia and Herzegovina. Although it is extremely polyphagous, it prefers to consume the leaves of various species of oaks. Browntail moth occurs periodically in high numbers (outbreak). Entomopathogenic fungus Entomophaga aulicae (Reichardt and Bail) Humber (Zygomycotina: Entomophtorales, Entomophtoraceae) is widespread Holarctic species, with many host insects from order Lepidoptera, where are some of the most economically harmful, outbreaking species of forest defoliators. In sessile oak forests of Eastern Bosnia and Herzegovina, the population density of browntail moth was determined by using route measurement during the growing season in the period 2015-2016. Browntail moth newly litters (40) were collected in four oak stands located in the region of Foča, Višegrad and Rogatica (PE Forests of the Republic of Srpska, Forest Estates Maglić, Panos and Sjemeć). In the litters, there were an average of 3,1 of dead old caterpillars and 4.7 pupae.The evaluation of E. aulicae infections was recorded as positive when hyphal bodies, primary conidia, or resting spores were detected on the surface of cadavers and puparia or in their tissues. The species identification was based on the size, shape and structural characteristics of different life forms of the fungus. By the microscopical studies of the causes of the mortality of the browntail moth larvae and pupae, the presence of hyphal bodies, primary conidia and resting spores of the E. aulicae were confirmed in them. The dimension of the resting spores (n=257) are 32.4 - 48.5 µm, a.v. 44.1 µm, primary conidia (n=54) 26.7-38.6 x 21.0-43.1 µm, a.v. 34.1-29.3 µm. Hyphal bodies were not measured. As entomopathogenic fungus on two development stages of the host, larvae and pupae, presented results indicate that E. aulicae is a promising microbial control agent.

scholarly journals Histopathological events and detection of Metarhizium anisopliae using specific primers in infected immature stages of the fruit fly Anastrepha fraterculus (Wiedemann, 1830) (Diptera: Tephritidae)

2011 ◽  
Vol 71 (1) ◽  
pp. 91-98 ◽  
Author(s):  
IJ. Bechara ◽  
RHR. Destéfano ◽  
C. Bresil ◽  
CL. Messias
Keyword(s):  
Metarhizium Anisopliae ◽  
Entomopathogenic Fungus ◽  
Large Scale ◽  
Microbial Control ◽  
Fruit Fly ◽  
Control Agent ◽  
Immature Stages ◽  
Disease Cycle ◽  
Anastrepha Fraterculus ◽  
Hyphal Bodies

The fungus Metarhizium anisopliae is used on a large scale in Brazil as a microbial control agent against the sugar cane spittlebugs, Mahanarva posticata and M. fimbriolata (Hemiptera., Cercopidae). We applied strain E9 of M. anisopliae in a bioassay on soil, with field doses of conidia to determine if it can cause infection, disease and mortality in immature stages of Anastrepha fraterculus, the South American fruit fly. All the events were studied histologically and at the molecular level during the disease cycle, using a novel histological technique, light green staining, associated with light microscopy, and by PCR, using a specific DNA primer developed for M. anisopliae capable to identify Brazilian strains like E9. The entire infection cycle, which starts by conidial adhesion to the cuticle of the host, followed by germination with or without the formation of an appressorium, penetration through the cuticle and colonisation, with development of a dimorphic phase, hyphal bodies in the hemocoel, and death of the host, lasted 96 hours under the bioassay conditions, similar to what occurs under field conditions. During the disease cycle, the propagules of the entomopathogenic fungus were detected by identifying DNA with the specific primer ITSMet: 5' TCTGAATTTTTTATAAGTAT 3' with ITS4 (5' TCCTCCGCTTATTGATATGC 3') as a reverse primer. This simple methodology permits in situ studies of the infective process, contributing to our understanding of the host-pathogen relationship and allowing monitoring of the efficacy and survival of this entomopathogenic fungus in large-scale applications in the field. It also facilitates monitoring the environmental impact of M. anisopliae on non-target insects.

scholarly journals Compatibility of microbial control agents Serratia entomophila and Beauveria bassiana with selected fertilisers

2003 ◽  
Vol 56 ◽  
pp. 118-122
Author(s):  
R.J. Townsend ◽  
M. O'Callaghan ◽  
V.W. Johnson ◽  
T.A. Jackson
Keyword(s):  
New Zealand ◽  
Beauveria Bassiana ◽  
Entomopathogenic Fungus ◽  
Deleterious Effect ◽  
Biocontrol Agent ◽  
Insect Pests ◽  
Microbial Control ◽  
Control Agent ◽  
Costelytra Zealandica ◽  
Direct Drilling

Microbial control agents targeting soildwelling organisms need to be compatible with commonly used fertilisers The bacterium Serratia entomophila is used as a microbial control agent for control of the New Zealand grass grub Costelytra zealandica and Beauveria bassiana is an entomopathogenic fungus used to control a range of insect pests These biocontrol agents were formulated into granules and applied to pots together with five fertilisers commonly used on pastures throughout New Zealand Compatibility with S entomophila was also assessed in a field trial where treatments were applied by direct drilling and surface application There appeared to be no deleterious effect from the application of the fertiliser treatments on the establishment and survival of either S entomophila or B bassiana On the contrary there was a suggestion that some nitrogenous fertilisers may lead to an increase in numbers of the bacterial biocontrol agent

scholarly journals DIVERSITY OF VASCULAR FLORA IN PROTECTED HABITAT TIŠINA

2020 ◽  
Vol 1 (23) ◽  
Author(s):  
Nataša Marić ◽  
Slađana Petronić
Keyword(s):  
Bosnia And Herzegovina ◽  
Protected Area ◽  
Life Forms ◽  
Iucn Red List ◽  
Red List ◽  
Effective Management ◽  
Vascular Flora ◽  
Far North ◽  
The Republic ◽  
Biological Spectrum

VelikaTišina swamp is located far north of the Republic of Srpska and Bosnia and Herzegovina, and belong to the territory of the Municipality of Šamac. The vascular flora was investigated within the Conservation Study, which was done in cooperation with the Republic Institute for the Protection of the Cultural and Historical Natural Heritage of the Republic of Srpska and GEF/UNEP as part of the project „Achieving Biodiversity Conservation through the Establishment and Effective Management of the Protected Area and Capacity Building for Nature Conservation Bosnia and Herzegovina“. Research was carried out in the period 2010-2011. There were identified 236 species that were classified into 3 classes, 179 genera and 71 families. In phytogeographic view is dominated species of wider geographical distribution from the eurasian, cosmopolitan, boreal and adventive areal groups. The biological spectrum indicate the hemicryptophytes-terrophytic-hydrophytic character of life forms. According to the IUCN Red List, about 55% of the species are mostly of low concern (LC) category, those species have a stable population but are not designated as dependent on protection nor nearly endangered. According to the Red List of Protected Species of the Flora and Fauna of the Republic of Srpska, in this area 22 taxa with no specific threat category were recorded and in the Red List of the Federation of BiH 6 species are in the vulnerable species (VU) category, 1 species in the LC category.

scholarly journals Possible Development of Tuta absoluta (Meyrick) on Different Host Plants in the Republic of Srpska (Bosnia and Herzegovina)

2017 ◽  
Vol 17 (4) ◽  
pp. 319
Author(s):  
Zorica Đurić ◽  
Snježana Hrnčić ◽  
Siniša Mitrić ◽  
Petar Nikolić
Keyword(s):  
Host Plant ◽  
Bosnia And Herzegovina ◽  
Host Plants ◽  
Solanum Melongena ◽  
First Record ◽  
Tuta Absoluta ◽  
Green Bean ◽  
Leaf Miner ◽  
The Republic ◽  
Banja Luka

Tomato leaf miner – Tuta absoluta Meyrick (Lepidoptera, Gelechiidae) is a serious pest of tomato. A study on possible grown host plants of T. absoluta was conducted during 2015 and 2016 in a greenhouse in the area of Banja Luka (Republic of Srpska, Bosnia and Herzegovina - BiH). As host plants the following were used: Solanum lycopersicum – tomato, Solanum tuberosum – potato, Solanum melongena – eggplant and Phaseolus vulgaris – green bean. The plants were placed into entomological cages and exposed to infestation of 10 adults of Tuta absoluta. Feeding damages by all larval instars and the number of developed generations per year at different host plants were observed under greenhouse conditions. The study showed that tomato is a preferable host plant. This paper is the first record of green bean as an incompatible host plant for T. absoluta in BiH.

First record of the Glossy Ibis(Plegadis falcinellus) in the Republic of Korea

2019 ◽  
Vol 26 (1) ◽  
pp. 26-28
Author(s):  
Chang Wan Kang ◽  
Eum Mi Kim ◽  
Jin Young Park ◽  
Hwa-Jung Kim ◽  
Jae Woong Hwang ◽  
...  
Keyword(s):  
First Record ◽  
Republic Of Korea ◽  
The Republic

Development of Interethnic Relations in Bosnia and Herzegovina in the First Decades after the Second World War

2018 ◽  
Vol 13 (3-4) ◽  
pp. 87-96
Author(s):  
Elena Yu. Guskova
Keyword(s):  
Ethnic Identity ◽  
Bosnia And Herzegovina ◽  
Second World War ◽  
The State ◽  
World War ◽  
Interethnic Relations ◽  
The Republic ◽  
State Of Affairs ◽  
First Time ◽  
Second World

The article is devoted to the analysis of interethnic relations in Bosnia and Herzegovina (BiH) in the 1940s and 1960s. The article is based on materials from the archives of BiH, Croatia, Slovenia, Yugoslavia. The documents show the state of affairs in the Republic – both in the economy and in ideology. In one or another way, all of them reflect the level of tension in the interethnic relations. For the first time, the article presents the discussion on interethnic relations, on the new phenomenon in multinational Yugoslavia – the emergence of a new people in BiH under the name of “Muslim”. The term “Muslims” is used to define the ethnic identity of Bosniaks in the territory of BiH starting from the 1961 census.

scholarly journals Physicochemical and structural characteristics of HEU-type zeolitic tuff treated by hydrochloric acid

2004 ◽  
Vol 69 (4) ◽  
pp. 273-282 ◽  
Author(s):  
Ana Radosavljevic-Mihajlovic ◽  
Vera Dondur ◽  
Aleksandra Dakovic ◽  
Jovan Lemic ◽  
Magdalena Tomasevic-Canovic
Keyword(s):  
Crystal Structure ◽  
Hydrochloric Acid ◽  
Bosnia And Herzegovina ◽  
Acid Treatment ◽  
Structural Characteristics ◽  
Chemical Analyses ◽  
Zeolitic Tuff ◽  
Zeolitic Tuffs ◽  
Before And After

Samples of natural HEU-type zeolites ? clinoptilolite-Ca, from the Novakovici deposit (near Prijedor, Bosnia and Herzegovina) were treated with the hydrochloric acid of various concentrations (from 10-3Mto 2M). Zeolitic tuffs before and after the acid treatment were examined using IR, XRPD, and chemical analyses. The changes in the crystal structure of acid treated samples showed a significant reduction in the crystallinity of zeolitic tuffs (60?70 %), which were effected by hydrochloric acid with concentrations of 1 M and above.

scholarly journals Parasporal Body Formation via Overexpression of the Cry10Aa Toxin of Bacillus thuringiensis subsp. israelensis, and Cry10Aa-Cyt1Aa Synergism

2009 ◽  
Vol 75 (14) ◽  
pp. 4661-4667 ◽  
Author(s):  
Alejandro Hernández-Soto ◽  
M. Cristina Del Rincón-Castro ◽  
Ana M. Espinoza ◽  
Jorge E. Ibarra
Keyword(s):  
Bacillus Thuringiensis ◽  
Gradient Centrifugation ◽  
Polyacrylamide Gel Electrophoresis ◽  
Sodium Dodecyl ◽  
Microbial Control ◽  
Control Agent ◽  
Mass Spectrometry Analysis ◽  
Parasporal Crystal ◽  
Spectrometry Analysis ◽  
Crystal Complex

ABSTRACT Bacillus thuringiensis subsp. israelensis is the most widely used microbial control agent against mosquitoes and blackflies. Its insecticidal success is based on an arsenal of toxins, such as Cry4A, Cry4B, Cry11A, and Cyt1A, harbored in the parasporal crystal of the bacterium. A fifth toxin, Cry10Aa, is synthesized at very low levels; previous attempts to clone and express Cry10Aa were limited, and no parasporal body was formed. By using a new strategy, the whole Cry10A operon was cloned in the pSTAB vector, where both open reading frames ORF1 and ORF2 (and the gap between the two) were located, under the control of the cyt1A operon and the STAB-SD stabilizer sequence characteristic of this vector. Once the acrystalliferous mutant 4Q7 of B. thuringiensis subsp. israelensis was transformed with this construct, parasporal bodies were observed by phase-contrast microscopy and transmission electron microscopy. Discrete, ca. 0.9-μm amorphous parasporal bodies were observed in the mature sporangia, which were readily purified by gradient centrifugation once autolysis had occurred. Pure parasporal bodies showed two major bands of ca. 68 and 56 kDa on sodium dodecyl sulfate-polyacrylamide gel electrophoresis analysis. These bands were further characterized by N-terminal sequencing of tryptic fragments using matrix-assisted laser desorption ionization-time of flight mass spectrometry analysis, which identified both bands as the products of ORF1 and ORF2, respectively. Bioassays against fourth-instar larvae of Aedes aegypti of spore-crystal complex and pure crystals of Cry10Aa gave estimated 50% lethal concentrations of 2,061 ng/ml and 239 ng/ml, respectively. Additionally, synergism was clearly detected between Cry10A and Cyt1A, as the synergistic levels (potentiation rates) were estimated at 13.3 for the mixture of Cyt1A crystals and Cry10Aa spore-crystal complex and 12.6 for the combination of Cyt1A and Cry10Aa pure crystals.

Sign in / Sign up

Export Citation Format

Share Document