scholarly journals Effect of biostimulants on soybean seedlings

2020 ◽  
Vol 25 (50) ◽  
pp. 99-104
Author(s):  
Gorica Cvijanović ◽  
Ninoslav Čolić ◽  
Nenad Đurić ◽  
Gordana Dozet ◽  
Abduladim Eltreki ◽  
...  
Keyword(s):  
Root Growth ◽  
Morphological Characteristics ◽  
Vegetable Crops ◽  
Single Application ◽  
Soybean Seedling ◽  
Soybean Seedlings ◽  
Seedling Root ◽  
Novi Sad

The aim of this study was to analyze the effect of biostimulants on the morphological characteristics of soybean seedlings. The testing was conducted in the laboratory of the Faculty of Biofarming in Bačka Topola. The experimental material included three soybean varieties ('Galina', 'Sava' and 'Rubin') selected at the Institute of Field and Vegetable Crops in Novi Sad. The study lasted for two years, 2015-2016, and identical biostimulant treatments were applied in both years. In order to determine the effect of biostimulants on soybean seedling root, hypocotyl and weight, the following commercial biostimulants were applied: EM Aktiv, Terra Green Hobby, Slavol and Bioplant Flora. In addition to the single application of biostimulants, two combinations of Slavol + Bioplant Flora and Slavol + Bioplant Flora + Epin Extra + Slavol S were used as treatments. EM Aktiv showed the greatest effect on root growth. The root was on average 12% longer than the control. Slavol S had the greatest influence on seedling hypocotyl and weight. The increase was 8.24% and 5.15%, respectively, compared with the control.

Uniconazole-induced thermotolerance in soybean seedling root tissue

1990 ◽  
Vol 79 (1) ◽  
pp. 78-84 ◽  
Author(s):  
Abha Upadhyaya ◽  
Tim D. Davis ◽  
M. H. Larsen ◽  
R. H. Walser ◽  
N. Sankhla
Keyword(s):  
Root Tissue ◽  
Soybean Seedling ◽  
Seedling Root ◽  
Induced Thermotolerance

scholarly journals First Report of Leaf Spot and Root Rot Caused by Phoma betae on Beta vulgaris subsp. vulgaris (Garden Beet Group) in Italy

Plant Disease ◽  
2007 ◽  
Vol 91 (11) ◽  
pp. 1515-1515 ◽  
Author(s):  
A. Garibaldi ◽  
G. Gilardi ◽  
D. Bertetti ◽  
M. L. Gullino
Keyword(s):  
Beta Vulgaris ◽  
Morphological Characteristics ◽  
Its Region ◽  
Pathogenicity Test ◽  
Vegetable Crops ◽  
Plastic Bags ◽  
Blastn Analysis ◽  
Commercial Farms ◽  
Pathogenicity Tests ◽  
Phoma Betae

In the winter of 2007 in Piedmont (northern Italy), symptoms of a previously unknown disease were observed on beet (Beta vulgaris L. subsp. vulgaris) (garden beet group) grown under a tunnel on several commercial farms near Cuneo. First symptoms appeared on 1-month-old plants, occurring as brown, round-to-oval spots as much as 2 cm in diameter with dark concentric rings near the perimeter. Small, dark pycnidia were present throughout the spots in concentric rings. Generally, older, lower leaves were affected more than the younger ones. Ten to fifteen percent of the plants were affected. Symptoms on the roots began near the crown as small, dark, sunken spots that became soft and water soaked. Eventually, spots on the roots turned dark brown to black and black lines separated diseased and healthy tissues. Older infected tissues were black, dry, shrunken, and spongy. Pycnidia were not observed on affected roots. From infected leaves and roots, a fungus was consistently isolated on potato dextrose agar (PDA) amended with 25 mg/l of streptomycin. The fungus was grown on PDA and maintained at 22°C (12 h of light, 12 h of dark). After 10 days, black pycnidia (130 to 328 [204] μm in diameter) developed, releasing abundant hyaline, elliptical, nonseptate conidia measuring 3.9 to 6.7 (5.1) × 2.4 to 5.9 (3.6) μm. On the basis of its morphological characteristics, the fungus was identified as a Phoma sp. (1). The internal transcribed spacer (ITS) region was amplified using primers ITS4/ITS6 (2) and sequenced. BLASTn analysis of the 557 bp obtained showed an E-value of 0.0 with Phoma betae. The nucleotide sequence has been assigned GenBank Accession No. EU003450. Pathogenicity tests were performed by spraying leaves of healthy 20-day-old potted B. vulgaris plants with a spore and mycelial suspension (1 × 106 spores or mycelial fragments per ml). Noninoculated plants sprayed only with water served as controls. Fifteen plants (three per pot) were used for each treatment. Plants were covered with plastic bags for 5 days after inoculation and kept in a growth chamber at 20°C. Symptoms previously described developed on leaves of all inoculated plants 5 days after inoculation, while control plants remained healthy. Later, pycnidia and conidia, with the same dimensions and characteristics previously described, were observed on the infected leaves. The fungus was consistently reisolated from the lesions of the inoculated plants. The pathogenicity test was carried out twice. P. betae on B. vulgaris var. cycla has been reported in Canada (3) as well as in other countries. The same pathogen was reported in Italy on sugar beet (2). References: (1) G. H. Boerema and G. J. Bollen. Persoonia 8:111, 1975. (2) A. Canova. Inf. Fitopatol. 16:207, 1966. (3) D. E L. Cooke and J. M. Duncan. Mycol. Res. 101:667, 1997. (4) J. R. Howard et al. Diseases of Vegetable Crops in Canada. Canadian Phytopathological Society, 1994.

scholarly journals Genetic diversity of common bean (Phaseolus vulgaris L.) breeding collection in Serbia

Genetika ◽  
2019 ◽  
Vol 51 (1) ◽  
pp. 1-15 ◽  
Author(s):  
Aleksandra Savic ◽  
Milka Brdar-Jokanovic ◽  
Miodrag Dimitrijevic ◽  
Sofija Petrovic ◽  
Milan Zdravkovic ◽  
...  
Keyword(s):  
Common Bean ◽  
Gene Pool ◽  
Gene Diversity ◽  
Principal Component ◽  
Molecular Data ◽  
Phenotypic Traits ◽  
Gene Pools ◽  
Vegetable Crops ◽  
Novi Sad

The characterization of 41 common bean cultivars and landraces from breeding collection of Institute of Field and Vegetable Crops, Novi Sad, Serbia, was done based on phenotypic traits and microsatellite markers. Phenotypic traits were chosen from Bioversity International descriptor list. In addition, main yield components were investigated. Analysis of phaseolin type revealed affiliation of cultivars and landraces to Mesoamerican or Andean gene pool. Cultivars and landraces demonstrated significant diversity level with regard to studied phenotypic traits. Identified variation showed high potential for developing new cultivars with desirable combination of traits. Principal component analysis based on phenotypic traits separated bean cultivars and landraces in two groups, which corresponded to Mesoamerican and Andean determined according to phaseolin type. Putative hybrids, with combination of traits between gene pools were also identified. Analysis of microsatellite data, using twenty-two SSR primer pairs, showed medium gene diversity in studied material. Microsatellite-based cluster analysis separated genotypes in two discrete clusters and several subclusters. No clear separation according to gene pool was found between the clusters, however grouping according to gene pool and patterns of phenotypic variation, following these gene pools, were observed within subclusters. Knowledge on detailed relationships of cultivars and landraces based on phenotypic and molecular data would facilitate identification of candidates for future breeding.

scholarly journals Micro-morphological features of achene of wild annual sunflowers

2016 ◽  
pp. 73-80 ◽  
Author(s):  
Jelena Lazarevic ◽  
Jadranka Lukovic ◽  
Sreten Terzic ◽  
Milan Jockovic ◽  
Lana Zoric ◽  
...  
Keyword(s):  
Plant Material ◽  
Morphological Diversity ◽  
Apical Part ◽  
Sem Analysis ◽  
Vegetable Crops ◽  
Trichome Density ◽  
Physiological Maturity ◽  
Novi Sad ◽  
Micro Morphology ◽  
Different Parts

The aim of this research is to characterize wild annual sunflowers on the basis of achene micro-morphology. Plant material was grown up on an experimental field of the Institute of Field and Vegetable Crops in Novi Sad during 2015. Achene samples were hand-collected at the time of physiological maturity. Morphological measurements of achenes were performed using stereoscopic microscope Leica MZ16 with Leica DFC 320 Camera. The micro-morphological diversity of achenes was assessed using scanning electron microscopy (SEM). Obtained results indicated the presence of some quantitative and qualitative differences in achene characteristics among analyzed species, such as in their size, color, carpopodium and stylopodium shape, and distribution of trichomes on the achene surface. The carpopodium of examined species was asymmetrical at the maturity. Differences in the cuticle and wax ornamentation in different parts of the achenes, on the anticlinal walls of epidermal cells, were identified. The SEM analysis revealed the presence of non-glandular, multicellular bi-seriate trichomes (twin hairs) on the achene surface. This trichome type consisted of two elongated, parallel cells of different length. Considering the distribution of trichomes among the apical, median and basal regions of the fruit, most of the species demonstrated greater trichome density in the apical part.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals Agro-ecological conditions and morphoproductive properties of spelt wheat

2013 ◽  
Vol 29 (3) ◽  
pp. 547-554 ◽  
Author(s):  
S. Jankovic ◽  
J. Ikanovic ◽  
V. Popovic ◽  
S. Rakic ◽  
J. Kuzevski
Keyword(s):  
Wheat Cultivar ◽  
Wheat Plant ◽  
Meteorological Conditions ◽  
Morphological Properties ◽  
Vegetable Crops ◽  
Spelt Wheat ◽  
Ecological Conditions ◽  
Different Types ◽  
Grey Forest Soil ◽  
Novi Sad

Experiments were conducted during 2011-2012, at three localities in Serbia (Valjevo, Nova Varos and Nova Pazova). The seed of spelt wheat cultivar Nirvana was used, having been selected at the Institute of Field and Vegetable Crops in Novi Sad. The objective of the research was to assess the effect of agro-ecological conditions on morphological and productive properties of spelt wheat grown on different types of soils. The effect of the locality was significantly expressed in all tested morphological properties of spelt wheat (plant height, number of spikelets, number of grains per spikelet), while meteorological conditions (year) affected spike length and grain mass per spike significantly. The average grain yield from all three localities was 3.20 t ha-1. A considerably higher yield was achieved on chernozem, locality Nova Pazova (3.89 t ha-1). The comparison of the grain yields from Valjevo (eutric cambisol) and Nova Varos (grey forest soil) did not show any significant differences.

Exudation of Glyphosate from Wheat (Triticum aestivum) Plants and Its Effects on Interplanted Corn (Zea mays) and Soybeans (Glycine max)

Weed Science ◽  
1982 ◽  
Vol 30 (3) ◽  
pp. 316-320 ◽  
Author(s):  
Joaquim J.V. Rodrigues ◽  
A. Douglas Worsham ◽  
Frederick T. Corbin
Keyword(s):  
Triticum Aestivum ◽  
Zea Mays ◽  
Glycine Max ◽  
Thin Layer ◽  
Fresh Weight ◽  
Soybean Seedling ◽  
Soybean Seedlings ◽  
Time Of Application ◽  
Seedling Plant ◽  
Layer Chromatography

Glyphosate [N-(phosphonomethyl)glycine] applied at 1.1 kg/ha to wheat [Triticum aestivum(L.) ‘Arthur 71′] plants increased height and fresh weight of soybean [Glycine max(L.) Merr. ‘Ransom′] seedlings planted in the pot at time of application of the glyphosate as the number of wheat plants treated increased from 5 to 30/pot. Height and fresh weight of the soybean seedlings also increased as the rate of glyphosate applied to wheat plants (5/pot) increased from 1.1 to 6.7 kg/ha. Increasing the rate of glyphosate from 1.1 to 6.7 kg/ha, however, reduced the height and fresh weight of soybeans when 30 wheat plants/pot were treated. In addition, when 6.7 kg/ha of glyphosate were applied to wheat plants, soybean-seedling plant height and fresh weight decreased as the density of wheat plants per pot increased from 5 to 30. The14C-glyphosate exuded into the soil from treated wheat plants was characterized by thin-layer chromatography. Trace amounts of the radio-label were present on thin-layer plates of leaf and stem extracts of corn (Zea maysL.) plants, which were growing in the same pots with the treated wheat plants. The zone of activity had the same Rf value as the glyphosate standard.

Sign in / Sign up

Export Citation Format

Share Document