scholarly journals Molecular Based Method Using PCR Technology on Porcine Derivative Detection for Halal Authentication

Genotyping ◽  
2018 ◽  
Author(s):  
Yuny Erwanto
Keyword(s):  
Pcr Technology ◽  
Halal Authentication

Development and application of molecular diagnostics and proteomics to bovine respiratory disease (BRD)

2020 ◽  
pp. 1-4
Author(s):  
John Dustin Loy
Keyword(s):  
Respiratory Disease ◽  
Bovine Respiratory Disease ◽  
Diagnostic Testing ◽  
Diagnostic Tools ◽  
Respiratory Pathogens ◽  
Opportunistic Pathogens ◽  
Ionization Time ◽  
Flight Mass Spectrometry ◽  
Pcr Technology ◽  
Multiple Pathogens

Abstract Advances in molecular and proteomic technologies and methods have enabled new diagnostic tools for bovine respiratory pathogens that are high-throughput, rapid, and extremely sensitive. Classically, diagnostic testing for these pathogens required culture-based approaches that required days to weeks and highly trained technical staff to conduct. However, new advances such as multiplex hydrolysis probe-based real-time PCR technology have enabled enhanced and rapid detection of bovine respiratory disease (BRD) pathogens in a variety of clinical specimens. These tools provide many advantages and have shown superiority over culture for co-infections/co-detections where multiple pathogens are present. Additionally, the integration of matrix-assisted laser desorption ionization time of flight mass spectrometry (MS) into veterinary diagnostic labs has revolutionized the ability to rapidly identify bacterial pathogens associated with BRD. Recent applications of this technology include the ability to type these opportunistic pathogens to the sub-species level (specifically Mannheimia haemolytica) using MS-based biomarkers, to allow for the identification of bacterial genotypes associated with BRD versus genotypes that are more likely to be commensal in nature.

Advanced qRT-PCR Technology Allows Detection of the Cholecystokinin 1 Receptor (CCK1R) Expression in Human Pancreas

Pancreas ◽  
2005 ◽  
Vol 31 (4) ◽  
pp. 325-331 ◽  
Author(s):  
Jose Galindo ◽  
Neil Jones ◽  
Garth L Powell ◽  
Simon J Hollingsworth ◽  
Nigel Shankley
Keyword(s):  
Human Pancreas ◽  
Qrt Pcr ◽  
Pcr Technology

Sensitivity of polymerase chain reaction (PCR)-southern hybridization and conventional PCR analysis for Halal authentication of gelatin capsules

LWT ◽  
2015 ◽  
Vol 63 (1) ◽  
pp. 714-719 ◽  
Author(s):  
Sahilah Abd Mutalib ◽  
Nursheila Mustafa Muin ◽  
Aminah Abdullah ◽  
Osman Hassan ◽  
Wan Aida Wan Mustapha ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Southern Hybridization ◽  
Pcr Analysis ◽  
Conventional Pcr ◽  
Chain Reaction ◽  
Gelatin Capsules ◽  
Halal Authentication ◽  
Polymerase Chain

scholarly journals Comparative Characteristics of Napsin A, TTF 1 and EGFR Mutation Expression in Mucinous Lung Cell Carcinomas

Folia Medica ◽  
2017 ◽  
Vol 59 (2) ◽  
pp. 174-182
Author(s):  
Sylvia N. Genova ◽  
Veselin T. Belovezhdov ◽  
Stoyan N. Bichev ◽  
Vladimir H. Danev
Keyword(s):  
Salivary Gland ◽  
Mutation Frequency ◽  
Egfr Mutation ◽  
Egfr Mutations ◽  
Common Pattern ◽  
Specificity And Sensitivity ◽  
Napsin A ◽  
Significant Difference ◽  
Pcr Technology ◽  
Lung Adenocarcinomas

AbstractBackground:Invasive mucinous lung adenocarcinomas are rare and account for 2%–10% of all lung adenocarcinoma cases. It is believed that Napsin A exhibits a weaker expression in mucinous adenocarcinomas compared with TTF1, but such correlation is still poorly researched.Aim:The aim of the study was to determine the frequency of mucinous to nonmucinous adenocarcinomas and compare specificity and sensitivity of monoclonal Napsin A with TTF1 in mucinous adenocarcinomas and define the frequency of EGFR mutations.Materials and methods:Eighty-four resected lung carcinomas were prospectively evaluated. All biopsies were analysed with p63, TTF1, monoclonal Napsin A, CK7, CK20 and CDX2 and were studied with real-time PCR technology.Results:In resected material we detected 49/84 (58.3%) adenocarcinomas and selected 21 mucinous adenocarcinomas out of 46 non-mucinous adenocarcinomas (45.6%). The most common pattern of mucinous adenocarcinomas is papillary - 24% and colloidal - 24%, followed by acinar - 19.2% and lepidic - 19.2%. mNapsin A was positive in 18/21 (85.7%) mucinous adenocarcinomas v/s 17/21 TTF1 positive (80.9%). EGFR mutations were detected in 3/21 cases with mucinous adenocarcinomas (14.3%): mucinous papillary, mucinous acinar and “salivary gland-like”.Conclusion:Our study demonstrates a high proportion of primary mucinous lung adenocarcinomas to primary non-mucinous adenocarcinomas. Sensitivity and specificity of mNapsin A and TTF1 did not show significant difference in pulmonary mucinous and non-mucinous adenocarcinomas, as mNapsin A gave greater sensitivity to mucinous adenocarcinomas. Our results indicate the same mutation frequency of EGFR in mucinous adenocarcinomas as mutation frequency detected in non-mucinous adenocarcinomas in the Bulgarian region.

scholarly journals Development of specific primers for the detection of HVA1 from barley in transgenic durum wheat by polymerase chain reaction (PCR) technology

2014 ◽  
Vol 13 (4) ◽  
pp. 581-592 ◽  
Author(s):  
Melloul Marouane ◽  
Iraqi Driss ◽  
M Udupa Sripada ◽  
Abdelaziz El Alaoui My ◽  
Amine Alaoui Sanaa ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Durum Wheat ◽  
Chain Reaction ◽  
Specific Primers ◽  
Pcr Technology ◽  
Polymerase Chain

Quantitative PCR Technology

1998 ◽  
pp. 97-110 ◽  
Author(s):  
Lincoln McBride ◽  
Ken Livak ◽  
Mike Lucero ◽  
Federico Goodsaid ◽  
Dane Carlson ◽  
...  
Keyword(s):  
Quantitative Pcr ◽  
Pcr Technology

Quantification of Lard in the Mixture with Olive Oil in Cream Cosmetics Based on FTIR Spectra and Chemometrics for Halal Authentication

2014 ◽  
Vol 69 (1) ◽  
Author(s):  
Abdul Rohman ◽  
Intan Gupitasari ◽  
Purwanto Purwanto ◽  
Kuwat Triyana ◽  
Arieff Salleh Rosman ◽  
...  
Keyword(s):  
Olive Oil ◽  
Ftir Spectroscopy ◽  
Multivariate Calibration ◽  
Virgin Olive Oil ◽  
Sampling Technique ◽  
Extra Virgin Olive Oil ◽  
Ftir Spectra ◽  
Halal Authentication ◽  
Extracting Solvent

The presence of lard (LD) in cosmetics products is a serious matter for certain religion, like Islam. The Muslim community is not allowed to use cosmetics products containing pig derivatives such as LD. Therefore, analysis of LD in cosmetics products is highly needed. The present study highlighted the employment of Fourier transform infrared (FTIR) spectroscopy in combination with chemometrics of multivariate calibration and principle component analysis (PCA) for quantitative analysis and classification of LD in the binary mixture with extra virgin olive oil (EVOO) as oil base in cream formulations for halal authentication. The lipid component in cream was extracted using liquid-liquid extraction using hexane as extracting solvent, and the lipid obtained was subjected to FTIR spectra measurement, using horizontal attenuated total reflectance as sampling technique. The result showed that FTIR spectroscopy in combination with partial least squares can be used to quantify the levels of LD in the mixture with EVOO in cosmetics creams using the combined frequency regions of 1785-702 cm-1 and 3020-2808 cm-1. PCA using absorbance intensities at 1200 – 1000 cm-1 as variables has been successfully used for the classification of cream with and without LD in the formulation. The developed method is rapid and not involving the excessive sample preparation.

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Sign in / Sign up

Export Citation Format

Share Document