scholarly journals Cytopathological changes in Schefflera actinophylla Harms. naturally infected with impatiens necrotic spot virus (INSV)

2014 ◽  
Vol 67 (3-4) ◽  
pp. 229-234
Author(s):  
Anna Rudzińska-Langwald ◽  
Maria Kamińska
Keyword(s):  
Endoplasmic Reticulum ◽  
Electron Microscope ◽  
Virus Particle ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Single Particles ◽  
Spot Virus ◽  
Stunted Growth ◽  
Necrotic Spots ◽  
In Cells

Plants of <em>Schefflera actinophylla</em> Harms. with stunted growth, chlorotic and necrotic spots and patterns, leaf epinasty and distortion are infected with impatiens necrotic spot virus classified as a member of genus <em>Tospovirus</em>. Studies with electron microscope revealed that in cells of <em>S. actinophylla</em> leaves there were no virus particle inclusions typical for <em>tospovirus</em> infection, but only single particles were present. The isolate of INSV was defective and the amount of INSV particles was strongly reduced in <em>Schefflera</em> plants. Some inclusions (I type) were composed of short branched cisterns of endoplasmic reticulum and a dark substance forming characteristic bands. The II type represented inclusions that were usually ballshaped and composed of a dark substance resembling that of the I type, but not accompanied by endoplasmic reticulum cisterns. The III type of inclusions was composed of dark, osmophilic masses. The inclusions present in the cells differ from those typical for tospovirus infection.

scholarly journals First Report of Impatiens necrotic spot virus on Hiemalis Begonia (Begonia × hiemalis) in Canada

Plant Disease ◽  
2013 ◽  
Vol 97 (2) ◽  
pp. 291-291 ◽  
Author(s):  
X. Tian ◽  
Y. Zheng ◽  
K. Chintaluri ◽  
B. Meng
Keyword(s):  
The United States ◽  
Economic Losses ◽  
N Gene ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
First Report ◽  
Initial Symptoms ◽  
Necrotic Spots ◽  
The Impact

Impatiens necrotic spot virus (INSV) is a member of the genus Tospovirus, and one of the prevalent viruses infecting ornamental plants, including begonia. Since the late 1980s, it has caused dramatic and unusual diseases on many flower crops, leading to considerable economic losses to the greenhouse floriculture industry (1). The western flower thrips, Frankliniella occidentalis (Pergande), is the only species currently known to vector INSV (1). In spring 2012, stunted plant growth and necrotic spots were observed on leaves of all Hiemalis begonias (Begonia × hiemalis Fotsch.) in a greenhouse in southwest Ontario, Canada. Initial symptoms were mosaic patterns, followed by necrotic spots on leaves, concentric rings, then necrotic areas on flowers, stem and vein necrosis, and finally stunting and burning of foliage similar to damage caused by sunburn or chemical injury. Thrips were observed colonizing nearby begonia plants. Leaf tissue from five symptomatic plants tested positive for INSV in a double-antibody sandwich (DAS)-ELISA with INSV-specific ImmunoStrips (Agdia Inc., Elkhart, IN). To confirm this, five of the leaf samples that were found to be positive for INSV in ELISA tests were mechanically inoculated to 10 plants of Hiemalis Begonia. Out of the 10 inoculated plants, eight produced necrotic local lesions and necrotic spots that are typical of INSV infection, followed by systemic infection of upper leaves 30 days after inoculation. The presence of INSV in the eight symptomatic plants was confirmed using the commercial INSV Pocket Diagnostic Kit (Forsite Diagnostics Ltd., York, UK) according to the manufacturer's instructions. Results showed that all eight symptomatic plants were positive for INSV. The other two plants were asymptomatic and tested negative for INSV. To further confirm the identity of this virus, total RNAs were isolated from symptomatic leave of begonia plants using TRIzol reagent (Invitrogen, Life Technologies Grand Island, NY) and amplified using reverse transcription (RT)-PCR analysis. A pair of primers was designed based on the consensus sequence of the N gene for a number of isolates retrieved from GenBank. These primers were INSV-F2286 (5′CCAAGCTCAACATGTTTAGC 3′, nt positions 2286 to 2305 of AB109100) and INSV-R2604 (5′ACTGCATCTTGCCTATCCTT 3′, nt positions 2664 to 2683 of AB109100). The expected amplification product of 398 bp was obtained, and was cloned into the vector pGEM-T Easy (Promega Corp., Madison, WI). Two clones were sequenced using the vector primer M13Forward. The sequences of these two clones were identical and the sequence was deposited in GenBank (Accession No. JX846907). BLAST analysis indicated that the sequence was 98 to 99% identical to INSV isolates from Japan (AB109100), the United States (D00914), and the Netherlands (X66972). To our knowledge, this is the first report of INSV infection in Begonia × hiemalis in Canada. This finding provides further evidence for the spread of the virus within North America. Further studies are required to determine the impact of INSV on the begonia industry in Canada and to determine viable management strategies, if necessary. Reference: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997.

scholarly journals First Report of Impatiens necrotic spot virus in Mexico in Tomatillo and Pepper Plants

Plant Disease ◽  
2013 ◽  
Vol 97 (8) ◽  
pp. 1124-1124 ◽  
Author(s):  
B. E. González-Pacheco ◽  
L. Silva-Rosales
Keyword(s):  
Mosaic Virus ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Post Inoculation ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
First Report ◽  
True Leaf ◽  
Necrotic Spots

Mexico contributes 20% of the total worldwide pepper exports (1). Impatiens necrotic spot virus (INSV) (genus Tospovirus; family Bunyaviridae) has emerged and has possibly caused diseases in various crops and ornamentals in Mexico. INSV was treated as a quarantine virus in Mexico (2) but not anymore. During the growing seasons of 2009 to 2011, surveys were conducted in the counties of Guanajuato and Querétaro in the states of the same names. Sampling included tomatillo (Physalis ixocarpa) and pepper (Capsicum spp.) plantations where plants with possible viral symptoms were observed. The symptoms observed were dark necrotic spots on some leaves and on the stems. These were similar to those observed elsewhere (3). Leaf spots further developed into localized necrotic areas. Using ELISA (Agdia, Elkhart, IN) with polyclonal antibodies, all collected samples showing symptoms tested positive for INSV and negative for Alfalfa mosaic virus (AMV), Cucumber mosaic virus (CMV), Potato X virus (PVX), Potato Y virus (PVY), Tobacco mosaic virus (TMV), Tomato spotted wilt virus (TSWV), Tobacco ringspot virus (TRSV), and Tomato ringspot virus (ToRSV). In order to identify the causal agent of these symptoms, INSV-specific sequences available for the S genomic fragments were obtained from NCBI GenBank. They were aligned and used to design primers to amplify a 250-bp fragment from total extracted RNA from healthy and symptomatic plants using reverse transcription (RT)-PCR. Primers used were INSVF (5′CCCAACTGCCTCTTTAGTGC3′) and INSVR (5′GGACAATGGATCTGCTCTGA3′). Three extracted plasmids, each containing an amplified and cloned fragment for the pepper and tomatillo isolates, were sequenced (GenBank Accession Nos. KC503051 and KC503052, respectively). Both nucleotide sequences showed 95% identity with the Chinese, Italian, and Japanese INSV sequences (FN400773, DQ425096, and AB207803, respectively) and 94% identity to other INSV isolates (4). The putative Mexican INSV pepper isolate, derived from a necrotic spot, was mechanically inoculated to other experimental host plants after grinding 1 g of symptomatic leaf tissue in 3 ml of a buffer with quaternary ammonium salts at 0.5%, pH 7.8. Ten plants, at the second true-leaf stage, of each Capsicum annuum cv. cannon and Citrullus lanatus were inoculated after carborundum abrasion of the second true leaf. At 15 days post inoculation, systemic chlorotic necrotic spots, stunting, and apical malformation were observed in capsicum plants while wilting was shown in watermelon plants. RT-PCR analyses and nucleotide sequence of the amplified product confirmed the presence and identity of both virus isolates. To our knowledge, this is the first report of INSV in Mexico found naturally in tomatillo and pepper and experimentally in watermelon plants. Derived from this report, INSV distribution in Mexico should be studied due to its potential impact on these two economically important crops. References: (1) Food and Agriculture Organization of the United Nations. FAOSTAT, retrieved online at http://faostat.fao.org , 2013. (2) DGSV-CNRF. Impatiens necrotic spot virus (INSV). SAGARPA-SENASICA. México, 2011. (3) M. Ding et al. Plant Dis. 95:357, 2011. (4) I. Mavrič et al. Plant Dis. 85:12, 2001.

scholarly journals Occurrence of Impatiens necrotic spot virus and Tomato spotted wilt virus on Potatoes in Iran

Plant Disease ◽  
2012 ◽  
Vol 96 (5) ◽  
pp. 771-771 ◽  
Author(s):  
R. Pourrahim ◽  
A. R. Golnaraghi ◽  
Sh. Farzadfar
Keyword(s):  
Tomato Spotted Wilt Virus ◽  
Natural Infection ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Leaf Sample ◽  
Potato Leaf ◽  
Spot Virus ◽  
Tomato Spotted Wilt ◽  
Necrotic Spots ◽  
Wilt Virus

There have been an increasing number of records of the natural infection of various crops and ornamentals in Iran with Impatiens necrotic spot virus (INSV), Tomato spotted wilt virus (TSWV), and Tomato yellow fruit ring virus (TYFRV), a recently proposed species in the genus Topovirus (3). TYFRV, originally believed to be TSWV and named as such, has been previously reported to occur in Iranian potato fields (2). During the growing seasons of 2004 to 2006, surveys were conducted in potato fields in different potato-producing (Solanum tuberosum) provinces of Iran (Ardabil, Azarbayejan-e-sharqi, Chaharmahal-va-bakhtiyari, Esfahan, Hamedan, Kerman, Khorasan, Khuzestan, Lorestan, Tehran, Qazvin, and Zanjan) to detect the presence of Tospovirus spp. infecting this crop, including Groundnut ringspot virus (GRSV), INSV, Iris yellow spot virus (IYSV), Tomato chlorotic spot virus (TCSV), TSWV, TYFRV, and Watermelon silver mottle virus (WSMoV). Overall, 186 fields were surveyed, and 2,823 potato leaf samples from plants showing tospovirus-like symptoms of chlorotic or necrotic spots, chlorosis, and necrosis were collected before or through the flowering stage, approximately 50 to 90 days after planting. Each leaf sample was tested by double-antibody sandwich (DAS)-ELISA using specific antisera (Bioreba, Reinach, Switzerland; Loewe, Sauerlach, Germany; DSMZ, Braunschweig, Germany) for the presence of the aforementioned tospoviruses. TYFRV, TSWV, and INSV were found in 24.0, 4.1, and 0.4% of the samples collected from 133, 51, and 7 fields surveyed, respectively. None of the samples had a positive reaction in ELISA to GRSV, IYSV, TCSV, and WSMoV. To confirm this testing, a number of the leaf samples that were found to be positive for INSV, TSWV, and TYFRV in ELISA tests were mechanically inoculated on Petunia × hybrid and Nicotiana benthamiana; the inoculated plants showed typical necrotic local lesions of tospoviruses and chlorotic or necrotic spots followed by systemic infection, respectively; their infection was subsequently confirmed by ELISA. The samples also were tested by reverse transcription-PCR technique using previously described specific primers (1,4). The PCR reaction resulted in the specific amplification of a 0.59-, 0.71-, and 0.67-kb (or 1.2-kb) fragment of INSV, TSWV, and TYFRV RNAs, respectively. This study showed that tospoviruses, especially TYFRV, are widespread in Iranian potato fields. It is hoped that the results may help us to improve a seed potato certification program in the future. To our knowledge, this is the first report of INSV and TSWV from potatoes in Iran. References: (1) A. R. Golnaraghi et al. Plant Dis. 92:1280, 2008. (2) R. Pourrahim et al. Plant Dis. 84:442, 2001. (3) S. Winter et al. Plant Pathol. 55:287, 2006. (4) H. Uga and S. Tsuda. Phytopathology 95:166, 2005.

scholarly journals Detection of a Severe Isolate of Impatiens Necrotic Spot Virus Infecting Lisianthus in Florida

Plant Disease ◽  
1997 ◽  
Vol 81 (11) ◽  
pp. 1334-1334 ◽  
Author(s):  
R. J. McGovern ◽  
J. E. Polston ◽  
B. K. Harbaugh
Keyword(s):  
Leaf Tissue ◽  
Impatiens Necrotic Spot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Mechanical Transmission ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Eustoma Grandiflorum ◽  
Systemic Necrosis ◽  
Low Incidence ◽  
Leaf Distortion

In May 1997, inclusions typical of a tospovirus were visualized by light microscopy in leaf tissue of lisianthus (Eustoma grandiflorum) exhibiting stunting, necrotic ringspots, leaf distortion, and systemic necrosis. Wilting and plant death were the final symptoms observed. Affected plants occurred at low incidence (<0.1%) in greenhouse-grown lisianthus in Manatee County, FL. Symptomatic tissue tested positive for impatiens necrotic spot virus (INSV) and negative for tomato spotted wilt virus (TSWV) with enzyme-linked immunosorbent assay (ELISA; Agdia, Elkhart, IN). Mechanical transmission of the virus to lisianthus and tomato was attempted by triturating 1 g of symptomatic leaf tissue in 7 ml of a buffer consisting of 0.01 M Tris and 0.01 M sodium sulfite, pH 7.3. Six plants of lisianthus cv. Maurine Blue and three of tomato (Lycopersicon esculentum) cv. Lanai at the second true-leaf stage were inoculated following abrasion of leaves with Carborundum. An equal number of controls were inoculated with buffer alone. Plants were maintained in a controlled environment chamber with a 12-h photoperiod, day/night temperatures of 21/16°C, and light intensity of 120 μE · s-l · m-2. Transmission rates were 100 and 0% to lisianthus and tomato, respectively. Chlorotic local lesions followed by chlorotic ringspots were observed in inoculated lisianthus leaves 4 days after inoculation. Stunting, leaf distortion, and necrotic ringspots appeared in noninoculated leaves of lisianthus plants within 3 to 4 weeks after inoculation. Buffer-inoculated lisianthus and all tomato plants remained symptomless and tested negative for INSV by ELISA. All symptomatic lisianthus tested positive for INSV by ELISA. The symptoms we observed in lisianthus due to infection by INSV were more severe than those previously reported in this host (1,2). The occurrence of such strains of INSV at high incidences could pose a significant threat for commercial lisianthus production. References: (1) M. K. Hausbeck et al. Plant Dis. 76:795, 1992. (2) H. T. Hsu and R. H. Lawson. Plant Dis. 75:292,1991.

scholarly journals First Report of Yellow Nutsedge (Cyperus esculentus) and Purple Nutsedge (C. rotundus) in Georgia Naturally Infected with Impatiens necrotic spot virus

Plant Disease ◽  
2004 ◽  
Vol 88 (7) ◽  
pp. 771-771 ◽  
Author(s):  
N. Martínez-Ochoa ◽  
S. W. Mullis ◽  
A. S. Csinos ◽  
T. M. Webster
Keyword(s):  
Southeastern United States ◽  
Impatiens Necrotic Spot Virus ◽  
Cyperus Esculentus ◽  
Necrotic Spot ◽  
Rt Pcr ◽  
Spot Virus ◽  
Black Shank ◽  
Purple Nutsedge ◽  
Yellow Nutsedge ◽  
Das Elisa

Impatiens necrotic spot virus (INSV), family Bunyaviridae, genus Tospovirus, is an emerging virus found mostly in ornamentals under greenhouse production. INSV has been detected in peanut (Arachis hypogaea L.) in Georgia and Texas (3) and recently in tobacco (Nicotiana tabacum L.) in the southeastern United States (2) but little is known about INSV distribution and impact on these crops. Noncrop plant hosts are likely to contribute to disease spread by serving as reservoirs for the virus and reproductive hosts for thrips (Frankliniella occidentalis Pergande), which transmit the virus. Yellow nutsedge, a native of North America, and purple nutsedge introduced from Eurasia, are considered serious weed problems in the southeastern United States. To date, there are no reports of natural INSV infections in these weeds. A survey was conducted at two research farms in Tift County, Georgia to determine if yellow and purple nutsedge plants were naturally infected with Tomato spotted wilt virus (TSWV) and INSV. The first field at the Black Shank Farm had been planted with flue-cured tobacco K-326 earlier in the year and fallow at the time of sampling. The second field at the Ponder Farm was planted at the time of sampling with yellow squash (Cucurbita pepo L.) and cabbage (Brassica oleracea L.). In early October 2002, 90 nutsedge plants were taken at random from each site. Leaf and root tissues of each of the nutsedge plants were tested for TSWV and INSV using double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) alkaline phosphatase antisera kits (Agdia Inc., Elkhart, IN). No visible symptoms of INSV or TSWV were observed. Samples from the field at the Black Shank Farm resulted in 2 of 26 positive for INSV in purple nutsedge plants and 6 of 64 in yellow nutsedge plants. At the Ponder Farm, 3 of 12 were positive for INSV in purple nutsedge plants and 14 of 78 in yellow nutsedge plants. None of the samples in either site tested positive for TSWV. The DAS-ELISA positive samples were verified for INSV using reverse transcription-polymerase chain reaction (RT-PCR) as previously described by Dewey et al. (1). Total RNA extracts were obtained from the DAS-ELISA positive nutsedge samples using RNeasy extraction kits (Qiagen Inc., Valencia, CA). The RT-PCR was carried out with primer 1F: 5′-TCAAG(C/T) CTTC(G/T)GAA(A/G)GTGAT 3′ (1) and primer 2R: 5′-ATGAACAAAGCAAAGATTACC 3′ specific to the 3′ end of the INSV N gene open reading frame (GenBank Accession No. NC003624). DAS-ELISA negative tissues of Cyperus esculentus L. and Emilia sonchifolia (L.) DC and an E. sonchifolia DAS-ELISA positive for INSV were included in the reactions as controls. All of the DAS-ELISA positive nutsedge samples yielded an amplification product with the expected size of 298 bp when PCR products were resolved by agarose (0.7%) gel electrophoresis. The relatively high occurrence of INSV found in the sampled fields may explain the recent increase in incidence of INSV in susceptible field crops. Although yellow nutsedge is more common than purple nutsedge in North America, the potential for dispersal of INSV in both species could be significant because of the nature of nutsedge tuber survival and spreading capabilities. References: (1) R. A. Dewey et al. J. Virol. Methods 56:19, 1996. (2) N. Martínez-Ochoa et al. On-line publication. doi:10.1094/PHP-2003-0417-01-HN. Plant Health Progress, 2003. (3) S. S. Pappu et al. Plant Dis. 83:966,1999.

scholarly journals First Report of Impatiens necrotic spot virus Infecting Greenhouse-Grown Potatoes in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (12) ◽  
pp. 1507-1507 ◽  
Author(s):  
J. M. Crosslin ◽  
L. L. Hamlin
Keyword(s):  
Frankliniella Occidentalis ◽  
Solanum Tuberosum L ◽  
Consensus Sequence ◽  
Western Flower Thrips ◽  
Alternaria Solani ◽  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Feeding Damage ◽  
Rt Pcr ◽  
Spot Virus

In April and May 2010, leaves on approximately one-half of 200 potato (Solanum tuberosum L. cv. Atlantic) plants, 20 to 25 cm high, grown from prenuclear minitubers in greenhouses located at the USDA-ARS facility in Prosser, WA exhibited necrotic spots similar to those produced by the early blight pathogen, Alternaria solani. Fungicide sprays did not reduce incidence of the symptoms. Observations associated the symptoms with thrips feeding damage so plants were tested for Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV) with ImmunoStrips from Agdia, Inc (Elkhart, IN). Three of three, two of two, and two of two symptomatic plants from three greenhouses were positive for INSV and negative for TSWV. Two symptomless plants tested negative. Four of four symptomatic and zero of two symptomless plants were positive by reverse transcription (RT)-PCR with INSV specific primers (forward: 5′ TAACACAACACAAAGCAAACC 3′ and reverse: 5′ CCAAATACTACTTTAACCGCA 3′) (4). The 906-bp amplicon from one sample was cloned and three clones were sequenced. The three clones were 99.7% identical, and BLAST analysis of the consensus sequence (GenBank Accession No. HM802206) showed 99% identity to INSV accessions D00914 and X66972, and 98% identity to other INSV isolates. The isolate, designated INSV pot 1, was mechanically inoculated to one plant of potato cv. GemStar and produced local, spreading necrotic lesions. The virus did not go systemic, as determined by RT-PCR of upper leaves 30 days after inoculation. The local necrotic lesions on GemStar were positive for INSV by ImmunoStrips and RT-PCR. The original source of the INSV inoculum is unknown. However, hairy nightshade (Solanum sarrachoides Sendtn.) and plantain (Plantago major L.) weeds in an ornamental planting near one of the affected greenhouses tested positive for INSV by ImmunoStrips. The nightshade showed obvious thrips feeding damage but no obvious virus symptoms while the plantain showed less thrips feeding damage but distinct necrotic rings. Subsequently, two of two symptomatic potato plants of cv. Desiree in another greenhouse near the initial site tested INSV positive with the ImmunoStrips. In addition to the necrotic lesions on leaves observed in cv. Atlantic, these plants also showed necrosis of petioles and stems. INSV is transmitted by a number of species of thrips, but the western flower thrips (Frankliniella occidentalis Perg.) is considered the most important under greenhouse conditions. The species of thrips in the affected greenhouses was not determined before all materials were discarded. Both INSV and the thrips vector have large host ranges including many crops and weeds, and have become increasingly important in recent years (1,2). INSV was reported on greenhouse-grown potatoes in New York in 2005 (3). These findings indicate INSV can be a major problem in greenhouse potatoes, whether for research purposes or production of virus-free minitubers destined for field plantings. References: (1) M. L. Daughtrey et al. Plant Dis. 81:1220, 1997. (2) R. A. Naidu et al. Online publication. doi:10.1094/PHP-2005-0727-01-HN, Plant Health Progress, 2005. (3) K. L. Perry et al. Plant Dis. 89:340, 2005. (4) K. Tanina et al. Jpn. J. Phytopathol. 67:42, 2001. ERRATUM: A correction was made to this Disease Note on September 7, 2012. The forward and reverse INSV specific primer sequences were corrected.

An Electron-Microscope Study of the in vitro Transformation of Human Leucocytes

1967 ◽  
Vol 2 (3) ◽  
pp. 359-370
Author(s):  
J. A. CHAPMAN ◽  
M. W. ELVES ◽  
J. GOUGH
Keyword(s):  
Endoplasmic Reticulum ◽  
Electron Microscope ◽  
Messenger Rna ◽  
Human Peripheral Blood ◽  
Limited Extent ◽  
Single Particles ◽  
Blast Cells ◽  
Protein Secreting

Electron-microscope studies of cultured small lymphocytes from human peripheral blood transforming into larger blastoid cells in the presence of phytohaemagglutinin (PHA) show that the transformed cell possesses the preliminary stages of development of a protein-synthesizing system. The transformed blastoid cell has abundant ribosomes, although, in contrast with in vivo protein-secreting cells, many of these occur as single particles with only a small proportion Linked in polysomal clusters. Endoplasmic reticulum membranes occur to a very limited extent and with a marked paucity of attached ribosomal particles; the few attached particles are usually located in groups. Some endoplasmic reticulum membranes revealed degenerative changes in otherwise normal cells. A moderately well-developed Golgi apparatus was a characteristic feature of the cells. Apart from the relatively low proportion of polysomes, in vitro PHA-transformed blastoid cells are identical in fine structure to in vivo blast cells (otherwise known as immunoblasts, haemocytoblasts, etc.) occurring in the immune response. It is suggested that messenger-RNA production in PHA-stimulated transformed cells may be reduced and that this could explain the limited number of polysomes and the restricted development of the endoplasmic reticulum.

SERIOUS DAMAGES BY IMPATIENS NECROTIC SPOT VIRUS IN ZANTEDESCHIA AETHIOPICA

2013 ◽  
pp. 319-325 ◽  
Author(s):  
S. Lazzereschi ◽  
B. Nesi ◽  
S. Pecchioli ◽  
A. Grassotti ◽  
D. Rizzo ◽  
...  
Keyword(s):  
Impatiens Necrotic Spot Virus ◽  
Necrotic Spot ◽  
Spot Virus ◽  
Zantedeschia Aethiopica

scholarly journals Characterization of Tomato Necrotic Spot Virus, a Subgroup 1 Ilarvirus Causing Necrotic Foliar, Stem, and Fruit Symptoms in Tomatoes in the United States

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1391-1396 ◽  
Author(s):  
Sara A. Bratsch ◽  
Samuel Grinstead ◽  
Tom C. Creswell ◽  
Gail E. Ruhl ◽  
Dimitre Mollov
Keyword(s):  
Genomic Sequence ◽  
The United States ◽  
Amino Acid Identity ◽  
Necrotic Spot ◽  
Coding Region ◽  
Spot Virus ◽  
Protein Coding ◽  
Serological Characterization ◽  
Necrotic Spots

The genomic, biological, and serological characterization of tomato necrotic spot virus (ToNSV), a virus first described infecting tomato in California, was completed. The complete genomic sequence identified ToNSV as a new subgroup 1 ilarvirus distinct from the previously described tomato-infecting ilarviruses. We identified ToNSV in Indiana in 2017 and 2018 and in Ohio in 2018. The coat protein coding region of the isolates from California, Indiana, and Ohio have 94 to 98% identity, while the same isolates had 99% amino acid identity. ToNSV is serologically related to TSV, a subgroup 1 ilarvirus, and shows no serological relationship to ilarviruses in the other subgroups. In tomato, ToNSV caused symptoms of necrotic spots and flecks on leaves, necrotic streaking on stems, and necrotic spots and circular patterns on fruit resulting in a yield loss of 1 to 13%. These results indicate that ToNSV is a proposed new subgroup 1 ilarvirus causing a necrotic spotting disease of tomato observed in California, Indiana, and Ohio.

Sign in / Sign up

Export Citation Format

Share Document