CONDITIONS FOR SYMPTOMATOLOGICAL DIFFERENTIATION OF BACTERIAL CANKER, SPOT, AND SPECK ON TOMATO SEEDLINGS

1966 ◽  
Vol 46 (5) ◽  
pp. 525-530 ◽  
Author(s):  
P. K. Basu
Keyword(s):  
Bacterial Canker ◽  
Bacterial Spot ◽  
Inoculum Concentration ◽  
Tomato Seedlings ◽  
Leaf Spots ◽  
Greenish Yellow ◽  
Brown Leaf ◽  
High Incidence ◽  
Bacterial Spot Disease ◽  
Xanthomonas Vesicatoria

Bacterial canker, spot, and speck of tomatoes (Lycopersicon esculentum Mill.) caused by Corynebacterium michiganense (E.F.S.) Jensen, Xanthomonas vesicatoria (Doidge) Dows., and Pseudomonas tomato (Okabe) Burk., respectively, were symptomatologically differentiated on 2- to 3-week-old spray-inoculated seedlings only under conditions of 87–97% relative humidity and 23–28 °C temperature. The numerical threshold of infection of both C. michiganense and P. tomato was 1 × 106 cells/ml and that of X. vesicatoria was 1 × 103 cells/ml. Preinoculation host injury and an inoculum concentration of 1 × 108 cells/ml were most favorable for high incidence of the diseases.Characteristic symptoms incited by the canker organism were (1) small whitish pimple-like spots developing into raised blister-like lesions on the lamina, (2) elongated swellings on veins, and (3) cankers on the hypocotyl. The distinctive symptoms of the bacterial spot disease were (1) small greenish-yellow to brown leaf spots, (2) large yellow blotches becoming necrotic and producing a severe blight effect on leaves, and (3) light-brown streaks on the hypocotyl. The distinguishing symptoms of the speck disease were discrete dark-brown spots and occasional marginal necrotic areas on leaves and cotyledons. On cotyledons, both C. michiganense and X. vesicatoria produced identical minute whitish flaky spots often with greenish centers. Sometimes these spots coalesced and resulted in wrinkling of the surface of the cotyledon.

scholarly journals First Report of Atypical Xanthomonas euvesicatoria Strains Causing Bacterial Spot of Tomato in Nigeria

Plant Disease ◽  
2015 ◽  
Vol 99 (3) ◽  
pp. 415-415 ◽  
Author(s):  
M. O. Jibrin ◽  
S. Timilsina ◽  
N. Potnis ◽  
G. V. Minsavage ◽  
K. C. Shenge ◽  
...  
Keyword(s):  
Phylogenetic Trees ◽  
Sequence Divergence ◽  
Housekeeping Genes ◽  
Housekeeping Gene ◽  
Bacterial Spot ◽  
Gene Sequences ◽  
Leaf Spots ◽  
Brown Leaf ◽  
Xanthomonas Species ◽  
Pathogenicity Tests

Bacterial spot (BS) is an important disease of tomato in Nigeria (2). Although a xanthomonad was isolated from tomato in Nigeria and characterized using phenotypic and pathogenicity tests, the bacterium was not characterized genetically to confirm the species. To determine the species associated with BS, leaves were collected in fields in northwestern Nigeria from tomato plants showing typical BS symptoms, which consisted of dark, irregular-shaped brown leaf spots that coalesced, resulting in a blighted appearance. Isolations from individual lesions were made on nutrient agar (NA). Yellow, mucoid colonies typical of Xanthomonas were isolated from 14 lesions and all were determined to be amylolytic (3). To determine the races of these strains, bacterial suspensions of the tomato strains, derived from 24-h cultures grown on NA at 28°C, were adjusted to 108 CFU/ml and infiltrated into leaves of tomato and pepper differential genotypes (5). The tomato strains elicited hypersensitive reactions (HRs) on the four pepper differential lines and an HR on the tomato genotype FL 216, which contains the R gene Xv3, but elicited susceptible reactions on the tomato genotypes Hawaii 7998 and Bonny Best. These reactions are typical of X. perforans tomato race 3 strains (5). Multilocus sequence analysis (MLSA) of six housekeeping genes (fusA, lacF, gyrB, gltA, gapA, and lepA) was used to further analyze four representative strains (1) (GenBank Accession Nos. KJ938581 to KJ938584, KJ938588 to KJ938591, KJ938595 to KJ938598, KJ938602 to KJ938605, KJ938629 to KJ938632, and KJ938636 to KJ938639, respectively). A partial sequence of hrpB2 was also made since the four Xanthomonas species associated with BS can be differentiated based on sequence divergence of this gene (3) (KJ938609 to KJ938621 and KJ938628). The housekeeping gene sequences were aligned along with other Xanthomonas sequences imported from the National Center for Biotechnology Information (NCBI) database ( www.ncbi.nlm.nih.gov ) using the MUSCLE tool from MEGA software, 5.2.2. Maximum likelihood phylogenetic trees constructed for the six housekeeping gene sequences individually and in concatenation revealed that the strains grouped most closely with the X. euvesicatoria reference strain 85-10 but more distantly to X. perforans. The hrpB2 sequence, which is highly conserved for each Xanthomonas species pathogenic on tomato (4), was sequenced from the tomato strains. These sequences were identical to the hrpB2 sequence from X. perforans strains but different from X. euvesicatoria. Although BS is common in Nigeria, to our knowledge, this represents a unique group of X. euvesicatoria strains from tomato that are identical to X. perforans based on pathogenic reactions on tomato and pepper and hrpB2 sequence identity but are more closely related to X. euvesicatoria based on the six housekeeping gene sequences. References: (1) N. F. Almeida et al. Phytopathology 100:208, 2010. (2) E. U. Opara and F. J. Odibo. J. Mol. Genet. 1:35, 2009. (3) J. B. Jones et al. Syst. Appl. Microbiol. 27:755, 2004. (4) A. Obradovic et al. Eur. J. Plant Pathol. 88:736, 2004. (5) R. E. Stall et al. Annu. Rev. Phytopathol. 47:265, 2009.

scholarly journals Complete Genome Sequences of Six Copper-Resistant Xanthomonas Strains Causing Bacterial Spot of Solaneous Plants, Belonging to X. gardneri, X. euvesicatoria, and X. vesicatoria, Using Long-Read Technology

2017 ◽  
Vol 5 (8) ◽  
Author(s):  
Damien Richard ◽  
Claudine Boyer ◽  
Pierre Lefeuvre ◽  
Blanca I. Canteros ◽  
Shyam Beni-Madhu ◽  
...  
Keyword(s):  
Complete Genome ◽  
Integrated Management ◽  
Bacterial Spot ◽  
Genome Sequences ◽  
Content Type ◽  
Resistant Phenotype ◽  
Long Read ◽  
Bacterial Spot Disease ◽  
Resistant Strains ◽  
Xanthomonas Vesicatoria

ABSTRACT Xanthomonas vesicatoria, Xanthomonas euvesicatoria, and Xanthomonas gardneri cause bacterial spot disease. Copper has been applied since the 1920s as part of integrated management programs. The first copper-resistant strains were reported some decades later. Here, we fully sequenced six Xanthomonas strains pathogenic to tomato and/or pepper and having a copper-resistant phenotype.

Effect of a protectant copper application on Psa infection of kiwifruit trap plants

2017 ◽  
Vol 70 ◽  
pp. 310-314
Author(s):  
J.L. Tyson ◽  
S.J. Dobson ◽  
M.A. Manning
Keyword(s):  
New Zealand ◽  
Disease Control ◽  
Pseudomonas Syringae ◽  
Low Risk ◽  
Bacterial Canker ◽  
Complete Protection ◽  
Leaf Spots ◽  
Copper Compounds ◽  
Trap Plants

Pseudomonas syringae pv. actinidiae (Psa) causes bacterial canker of kiwifruit, which is an ongoing threat to New Zealand kiwifruit production. Disease control depends on orchard practices such as removal of visibly diseased material, pruning during low-risk periods, and the application of foliar bactericides. Although the use of copper compounds on Actinidia species (kiwifruit) can cause phytotoxicity, copper-based formulations remain a key component of Psa control in New Zealand. The effect of single copper applications on Psa infection of ‘Hort16A’ trap plants was studied over the Spring of 2014 (Sept—Nov). Psa leaf spots were observed at the beginning of October, appearing first on the untreated plants. Although the copper sprays did not achieve complete protection, particularly as the inoculum built up during November, the copper-sprayed plants always had less disease than the untreated plants.

Erratum to “Reclassification of the Xanthomonads Associated with Bacterial Spot Disease of Tomato and Pepper”

2006 ◽  
Vol 29 (1) ◽  
pp. 85-86 ◽  
Author(s):  
Jeffrey B. Jones ◽  
George H. Lacy ◽  
Hacene Bouzar ◽  
Robert E. Stall ◽  
Norman W. Schaad
Keyword(s):  
Bacterial Spot ◽  
Spot Disease ◽  
Bacterial Spot Disease

Cercostigmina protearum var. protearum. [Descriptions of Fungi and Bacteria].

1999 ◽  
Author(s):  
P. M. Kirk
Keyword(s):  
South Africa ◽  
Geographical Distribution ◽  
Leaf Spots ◽  
Brown Leaf

Abstract A description is provided for Cercostigmina protearum var. protearum. Information is included on the disease caused by the organism, its transmission, geographical distribution, and hosts. DISEASE: Causing round or sometimes irregular, pale brown or greyish-brown leaf spots 5-17 mm diameter. HOSTS: Leucospermum conocarpum, Protea. TRANSMISSION: By air-borne conidia. GEOGRAPHICAL DISTRIBUTION: AFRICA: South Africa.

scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

scholarly journals First Report of a Septoria sp. on Common Ragweed (Ambrosia artemisiifolia) in Europe

Plant Disease ◽  
1999 ◽  
Vol 83 (7) ◽  
pp. 696-696 ◽  
Author(s):  
Gy. Bohár ◽  
I. Schwarczinger
Keyword(s):  
Ambrosia Artemisiifolia ◽  
Voucher Specimen ◽  
Common Ragweed ◽  
History Museum ◽  
First Report ◽  
Leaf Spots ◽  
Brown Leaf ◽  
Detached Leaves ◽  
Pure Cultures ◽  
Hungarian Natural History Museum

During a survey for potential biocontrol agents of common ragweed (Ambrosia artemisiifolia var. elatior (L.) Descourt) in 1997, plants exhibiting irregular, brown leaf spots were collected repeatedly from six roadside locations in Pest County, Hungary. Many pycnidia developed in the necrotic tissues on detached leaves after 2 days in moist chambers. Pycnidia were globose to slightly flattened, brown, thin walled, 58 to 100 μm in diameter, with a definite ostiole. Conidia were hyaline, filiform with 2 to 3 septa, and 22.0 to 38.0 × 0.7 to 1.3 μm in size. The fungus was isolated on potato dextrose agar and identified as a Septoria sp. To confirm pathogenicity, potted ragweed seedlings were sprayed with a suspension of 5 × 106 conidia per ml from pure cultures of the Septoria sp., placed in a dew chamber for 72 h, and then grown in a greenhouse at 16 to 24°C. After 2 weeks, inoculated plants developed small, brown lesions on leaves and leaf petioles. Three weeks after inoculation, necrotic lesions had enlarged to 1 to 3 mm in diameter with irregular, distinct margins and light brown centers. The lesions on the lower leaves were larger and more numerous than on leaves nearer the tops of the plants. Pycnidia developed on the senescent leaves after 1 month. Infected leaves became completely necrotic and occasionally entire plants died. The pathogen was reisolated from all inoculated plants, thus satisfying Koch's postulates. A voucher specimen was deposited at the Department of Botany of the Hungarian Natural History Museum in Buda-pest (No. BP 92081). Septoria ambrosiae Hemmi et Naito was described on ragweed in Japan (1), but our isolate is morphologically distinct from that species. This is the first report of a Septoria sp. on A. artemisiifolia in Europe. Reference: (1) N. Naito. Mem. Coll. Agric. Kyoto 47:41, 1940.

Sign in / Sign up

Export Citation Format

Share Document