scholarly journals Molecular characterization of three enteroviral strains isolated in Kuwait from young children with serious conditions

2017 ◽  
Vol 11 (08) ◽  
pp. 626-639
Author(s):  
Wassim Chehadeh ◽  
Sanaa Abdulkader Moalim Ali ◽  
Syeda Mubeen Maimoona
Keyword(s):  
Molecular Characterization ◽  
Sequence Divergence ◽  
Full Genome Sequencing ◽  
Noncoding Regions ◽  
Nonsynonymous Substitutions ◽  
Coding Regions ◽  
Amino Acid Levels ◽  
Synonymous And Nonsynonymous Substitutions ◽  
Sanger Method

Introduction: Human enteroviruses are single stranded RNA viruses associated with many serious diseases such as encephalitis and myocarditis. They consist of up to 100 immunologically and genetically distinct types. Three enteroviral isolates, 2104, 3936 and 3988, were previously isolated from patients with neurological disorders or sepsis-like illness. In this study, the molecular characterization of the three isolates was investigated. Methodology: A full genome sequencing was performed by Sanger method, followed by phylogenetic and bootscanning analyses. A detailed analysis of genetic differences between the clinical and prototype isolates were investigated by mapping polymorphisms at nucleotide and amino acid levels, and by comparing RNA secondary structure in the noncoding regions. Results: Based on the phylogenetic analysis of the VP1 gene and complete genome, 2104 was typed as coxsackievirus B1, 3936 as coxsackievirus B5, and 3988 as echovirus 7. Similarity and bootscan plots provided support for intra- and intertypic recombination crossover points occurring mainly along the nonstructural coding regions of the isolates. A sequence divergence of 12 to 14% was detected in the 5’-noncoding region between the clinical isolates and their corresponding prototype strains. Synonymous and nonsynonymous substitutions could be also mapped to different coding regions of the isolates, including those coding for the Puff, Knob and the hydrophobic pocket of the capsid. Examination of relative frequencies of synonymous and nonsynonymous substitutions in different coding regions of enteroviral isolates showed no evidence for selective pressure. Conclusion: The results provided a better understanding of the genetic variations, evolution and adaptation of enteroviruses in Kuwait.

scholarly journals Molecular characterization of the porcine <i>DNAL4</i> gene

2007 ◽  
Vol 50 (3) ◽  
pp. 267-272
Author(s):  
B. Uhlmann ◽  
H. Kuiper ◽  
O. Distl ◽  
T. Leeb
Keyword(s):  
Amino Acids ◽  
Molecular Characterization ◽  
Axonal Transport ◽  
Light Chain ◽  
Motor Proteins ◽  
Coding Regions ◽  
Naturally Occurring ◽  
Human Ortholog

Abstract. The DNAL4 (dynein, axonemal, light polypeptide 4) gene encodes a light chain of dynein. Dyneins are motor proteins that contribute to axonal transport. Cloning and characterization of the porcine DNAL4 revealed a conserved organization with respect to the human ortholog. The porcine DNAL4 gene consists of 4 exons and codes for a peptide of 105 amino acids. The porcine DNAL4 gene is located on SSC5p15. Analysis of the naturally occurring variation of the DNAL4 gene in pigs from the Piétrain und Duroc breeds revealed five SNPs in non-coding regions of the gene.

scholarly journals Characterization of mussel H2A.Z.2: a new H2A.Z variant preferentially expressed in germinal tissues from Mytilus

2016 ◽  
Vol 94 (5) ◽  
pp. 480-490 ◽  
Author(s):  
Ciro Rivera-Casas ◽  
Rodrigo González-Romero ◽  
Ángel Vizoso-Vazquez ◽  
Manjinder S. Cheema ◽  
M. Esperanza Cerdán ◽  
...  
Keyword(s):  
Expression Patterns ◽  
Sequence Divergence ◽  
Genotoxic Stress ◽  
Histone Variants ◽  
Coding Regions ◽  
Eukaryotic Chromatin ◽  
Core Histones ◽  
And Function ◽  
First Time

Histones are the fundamental constituents of the eukaryotic chromatin, facilitating the physical organization of DNA in chromosomes and participating in the regulation of its metabolism. The H2A family displays the largest number of variants among core histones, including the renowned H2A.X, macroH2A, H2A.B (Bbd), and H2A.Z. This latter variant is especially interesting because of its regulatory role and its differentiation into 2 functionally divergent variants (H2A.Z.1 and H2A.Z.2), further specializing the structure and function of vertebrate chromatin. In the present work we describe, for the first time, the presence of a second H2A.Z variant (H2A.Z.2) in the genome of a non-vertebrate animal, the mussel Mytilus. The molecular and evolutionary characterization of mussel H2A.Z.1 and H2A.Z.2 histones is consistent with their functional specialization, supported on sequence divergence at promoter and coding regions as well as on varying gene expression patterns. More precisely, the expression of H2A.Z.2 transcripts in gonadal tissue and its potential upregulation in response to genotoxic stress might be mirroring the specialization of this variant in DNA repair. Overall, the findings presented in this work complement recent reports describing the widespread presence of other histone variants across eukaryotes, supporting an ancestral origin and conserved role for histone variants in chromatin.

scholarly journals Identification of some nucleotide mutations in Waxy gene (BGIOSGA022241) of a mutant rice line

2021 ◽  
Vol 8 (3) ◽  
pp. 36-52
Author(s):  
Hong Nguyen Thi ◽  
Yoshikazu Tanaka ◽  
Tuyen Vo Thi Minh ◽  
Ham Le Huy
Keyword(s):  
Point Mutations ◽  
Waxy Gene ◽  
Local Alignment ◽  
Mutant Type ◽  
Noncoding Regions ◽  
Coding Regions ◽  
Search Tool ◽  
Exon 9 ◽  
Exon 4 ◽  
Sanger Method

Waxy genes of the original variety and its mutant type were sequenced by Sanger method and compared through Nucleotide Basic Local Alignment Search Tool (BLASTN) to clarify differences. BLASTN result showed four nucleotide mutations in coding regions and 59 nucleotide mutations in noncoding regions. Four point mutations in coding regions were: the deletion of T/- at position 34 and the insertion of -/T between positions 70 and 71 in exon 3; the substitution of C/T at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9. In 59 mutant nucleotides in non-coding regions, somesignificant alterations were list: the deletion of nucleotide G at the first of intron 6 and the addition of 32 nucleotides “GGGCCTGCGAAGAACTGGGAGAATGTGCTCCT” at the end of intron 12. For the first trial, a new DNA marker was developed based on the mutation C/T at at position 14 in exon 4 and the substitution of T/C at position 115 in exon 9 to improve efficiency of rice breeding relevant to Waxy gene.

1446: Molecular Characterization of Cyclooxygenase-2 in a Stimulated Prostate Stroma Cells

2006 ◽  
Vol 175 (4S) ◽  
pp. 467-467
Author(s):  
Victor K. Lin ◽  
Shih-Ya Wang ◽  
Claus G. Roehrbom
Keyword(s):  
Molecular Characterization ◽  
Cyclooxygenase 2 ◽  
Prostate Stroma
Sign in / Sign up

Export Citation Format

Share Document