Comparison of cultural growth and in planta quantification of Didymella pinodes, Phoma koolunga and Phoma medicaginis var. pinodella, causal agents of ascochyta blight on field pea (Pisum sativum)

Mycologia ◽  
2012 ◽  
Vol 104 (1) ◽  
pp. 93-101 ◽  
Author(s):  
J.A. Davidson ◽  
M. Krysinska-Kaczmarek ◽  
Herdina A. McKay ◽  
E.S. Scott
Keyword(s):  
Pisum Sativum ◽  
Ascochyta Blight ◽  
Field Pea ◽  
In Planta ◽  
Didymella Pinodes ◽  
Phoma Medicaginis ◽  
Phoma Koolunga

scholarly journals Distribution and Survival of Ascochyta Blight Pathogens in Field-Pea-Cropping Soils of Australia

Plant Disease ◽  
2011 ◽  
Vol 95 (10) ◽  
pp. 1217-1223 ◽  
Author(s):  
J. A. Davidson ◽  
M. Krysinska-Kaczmarek ◽  
C. J. Wilmshurst ◽  
A. McKay ◽  
Herdina ◽  
...  
Keyword(s):  
Ascochyta Blight ◽  
South Australia ◽  
Field Trials ◽  
Field Pea ◽  
Minor Role ◽  
Infested Soil ◽  
Soilborne Pathogens ◽  
Didymella Pinodes ◽  
Phoma Koolunga ◽  
A Minor

Phoma koolunga, Didymella pinodes, and P. medicaginis var. pinodella were detected in DNA extracted from soil following field pea crops across four states in the southeastern and western regions of Australia. P. koolunga was commonly detected in soil from South Australia but rarely in other states whereas D. pinodes plus P. medicaginis var. pinodella were widespread in all regions tested. The quantity of DNA of these pathogens detected in soils prior to growing field pea was positively correlated with ascochyta blight lesions on field pea subsequently grown in infested soil in a pot bioassay and also on field pea in naturally infected field trials. The quantity of DNA of the soilborne pathogens was greatest following a field pea crop and gradually decreased in the following 3 years. The DNA tests were used to quantify the DNA of the pathogens in field pea plants sampled from naturally infected field trials in South Australia over two seasons. The combined results of DNA tests and pathogen isolation from the plants indicated that P. koolunga and D. pinodes were equally responsible for the ascochyta blight symptoms in the diseased trials, while P. medicaginis var. pinodella had a minor role in the disease complex.

scholarly journals Relative Host Resistance to Black Spot Disease in Field Pea (Pisum sativum) is Determined by Individual Pathogens

Plant Disease ◽  
2015 ◽  
Vol 99 (5) ◽  
pp. 580-587 ◽  
Author(s):  
Hieu Sy Tran ◽  
Ming Pei You ◽  
Tanveer N. Khan ◽  
Martin J. Barbetti
Keyword(s):  
Pisum Sativum ◽  
Host Resistance ◽  
Ascochyta Blight ◽  
Black Spot ◽  
Field Pea ◽  
Breeding Programs ◽  
Didymella Pinodes ◽  
Progress Curve ◽  
The Individual ◽  
Important Disease

Black spot, also known as Ascochyta blight, is the most important disease on field pea (Pisum sativum). It is caused by a complex of pathogens, the most important of which in Australia include Didymella pinodes, Phoma pinodella, and P. koolunga. The relative proportions of these and other component pathogens of the complex fluctuate widely across time and geographic locations in Australia, limiting the ability of breeders to develop varieties with effective resistance to black spot. To address this, 40 field pea genotypes were tested under controlled environment conditions for their individual stem and leaf responses against these three pathogens. Disease severity was calculated as area under disease progress curve (AUDPC), and subsequently converted to mean rank (MR). The overall rank (OR) for each pathogen was used to compare response of genotypes under inoculation with each pathogen. The expressions of host resistance across the field pea genotypes were largely dependent upon the individual test pathogen and whether the test was on stem or leaf. Overall, P. koolunga caused most severe stem disease; significantly more severe than either D. pinodes or P. pinodella. This is the first report of the host resistance identified in field pea to P. koolunga; the five genotypes showing highest resistance on stem, viz. 05P778-BSR-701, ATC 5338, ATC 5345, Dundale, and ATC 866, had AUDPC MR values <250.4, while the AUDPC MR values of the 19 genotypes showing the best resistance on leaf was less than 296.8. Two genotypes, ATC 866 and Dundale, showed resistance against P. koolunga on both stem and leaf. Against D. pinodes, the four and 16 most resistant genotypes on stem and leaf had AUDPC MR values <111.2 and <136.6, respectively, with four genotypes showing resistance on both stem and leaf including 05P770-BSR-705, Austrian Winter Pea, 06P822-(F5)-BSR-6, and 98107-62E. Against P. pinodella, four and eight genotypes showing the best resistance on stem and leaf had AUDPC MR values <81.3 and <221.9, respectively; three genotypes, viz. 98107-62E, Dundale, and Austrian Winter Pea showed combined resistance on stem and leaf. A few genotypes identified with resistance against two major pathogens of the complex will be of particular significance to breeding programs. These findings explain why field pea varieties arising from breeding programs in Australia fail to display the level or consistency of resistance required against black spot and why there needs to be a wider focus than D. pinodes in breeding programs.

Fungicidal control of ascochyta blight of field pea

1996 ◽  
Vol 76 (1) ◽  
pp. 67-71 ◽  
Author(s):  
T. D. Warkentin ◽  
K. Y. Rashid ◽  
A. G. Xue
Keyword(s):  
Pisum Sativum ◽  
Key Words ◽  
Untreated Control ◽  
Seed Weight ◽  
Ascochyta Blight ◽  
Field Pea ◽  
Mycosphaerella Pinodes ◽  
Yield Increase ◽  
Pisum Sativum L

The use of fungicides for the control of ascochyta blight in field pea was investigated. Four fungicides were applied to the cultivars AC Tamor and Radley at two locations in Manitoba in 1993 and 1994. Fungicides were applied either once, twice, or three times at 10-d intervals, beginning at the initiation of flowering. Chlorothalonil and benomyl were effective m reducing the severity of ascochyta blight and increasing the yield and seed weight of field pea. The triple application of chlorothalonil resulted in a mean yield increase of 33% over that of the untreated control. Iprodione and propiconazole were relatively ineffective in controlling ascochyta blight. The percentage of seedborne ascochyta was not significantly affected by fungicide treatments. The severity of ascochyta blight was greater in 1993 that in 1994, resulting in greater benefits of chlorothalonil and benomyl applications in 1993. Key words: Field pea, Pisum sativum L., ascochyta blight, Mycosphaerella pinodes, fungicide

Host range investigation of Phoma koolunga, a causal agent of ascochyta blight of field pea

2020 ◽  
Vol 49 (6) ◽  
pp. 707-719
Author(s):  
E. C. Keirnan ◽  
J. A. Davidson ◽  
R. L. Correll ◽  
E. S. Scott
Keyword(s):  
Host Range ◽  
Ascochyta Blight ◽  
Causal Agent ◽  
Field Pea ◽  
Phoma Koolunga

scholarly journals First Report of Phoma glomerata Associated with the Ascochyta Blight Complex on Field Pea (Pisum sativum) in Australia

Plant Disease ◽  
2014 ◽  
Vol 98 (3) ◽  
pp. 427-427 ◽  
Author(s):  
H. S. Tran ◽  
M. P. You ◽  
V. Lanoiselet ◽  
T. N. Khan ◽  
M. J. Barbetti
Keyword(s):  
Pisum Sativum ◽  
Western Australia ◽  
Ascochyta Blight ◽  
Field Pea ◽  
Post Inoculation ◽  
Conidial Suspension ◽  
Single Spore ◽  
First Report ◽  
Representative Isolate ◽  
Eastern Australia

The ascochyta blight complex on field pea (Pisum sativum) in Australia causes severe yield loss of up to 60% (1). This blight complex includes a range of different symptoms, including ascochyta blight, foot rot, and black stem and leaf and pod spot (together more commonly known as “black spot disease” in Australia). In Australia, disease is generally caused by one or more of the four fungi: Didymella pinodes, Phoma pinodella, Ascochyta pisi, and P. koolunga (1,2). However, in September 2012, from a field pea disease screening nursery at Medina, Western Australia, approximately 1% of isolates were a Phoma sp. morphologically different to any Phoma sp. previously reported on field pea in Australia. The remaining isolates were either D. pinodes or P. pinodella. Single spore isolations of two isolates of this Phoma sp. were made onto Coon's Agar and DNA extracted. Two PCR primers TW81 (5′GTTTCCGTAGGTGAACCTGC 3′) and AB28 (5′ATATGCTTAAGTTCAGCGGGT 3′) were used to amplify extracted DNA from the 3′ end of 16S rDNA, across ITS1, 5.8S rDNA, and ITS2 to the 5′ end of the 28S rDNA. The PCR products were sequenced and BLAST analyses used to compare sequences with those in GenBank. In each case, the sequence had ≥99% nucleotide identity with the corresponding sequence in GeneBank for P. glomerata. Isolates also showed morphological similarities to P. glomerata as described in other reports (3). The relevant information for a representative isolate has been lodged in GenBank (Accession No. KF424434). The same primers were used by Davidson et al. (2) to identify P. koolunga, but neither of our two isolates were P. koolunga. A conidial suspension of 106 conidia ml–1 from a single spore culture was spot-inoculated onto foliage of 20-day-old plants of P. sativum variety WAPEA2211 maintained under >90% RH conditions for 72 h post-inoculation. Symptoms on foliage first became evident by 8 days post-inoculation, consisting of dark brown lesions 1 to 2.5 mm in diameter. P. glomerata was readily re-isolated from infected foliage to fulfill Koch's postulates. No lesions occurred on foliage of control plants inoculated with only deionized water. A culture of this representative isolate has been lodged in the Western Australian Culture Collection Herbarium maintained at the Department of Agriculture and Food Western Australia (Accession No. WAC13652). While not reported previously on P. sativum in Australia, P. glomerata has been reported on other legume crop and pasture species in eastern Australia, including Cicer arietinum (1973), Lupinus angustifolius (1982), Medicago littoralis (1983), M. truncatula (1985), and Glycine max (1986) (Australian Plant Pest Database). Molecular analysis of historical isolates collected from P. sativum in Western Australia, mostly in the late 1980s and 1990s, did not show any incidence of P. glomerata, despite this fungus being previously reported on Citrus, Cocos, Rosa, Santalum, and Washingtonia in Western Australia (4). We believe this to be the first report of P. glomerata as a pathogen on field pea in Australia. The previous reports of P. glomerata on other crop legumes in eastern Australia and its wide host range together suggest potential for this fungus to be a pathogen on a range of leguminous genera/species. References: (1) T. W. Bretag et al. Aust. J. Agric. Res. 57:883, 2006. (2) J. A. Davidson et al. Mycologica 101:120, 2009. (3) G. Morgan-Jones. CMI Descriptions of Pathogenic Fungi and Bacteria No.134 Phoma glomerata, 1967. (4) R. G. Shivas. J. Roy. Soc. West. Aust. 72:1, 1989.

Genetic variation in stem strength in field pea (Pisum sativum L.) and its association with compressed stem thickness

2006 ◽  
Vol 57 (2) ◽  
pp. 193 ◽  
Author(s):  
C. P. Beeck ◽  
J. Wroth ◽  
W. A. Cowling
Keyword(s):  
Genetic Variation ◽  
Pisum Sativum ◽  
Ascochyta Blight ◽  
Testing Machine ◽  
Quantitative Measure ◽  
Field Pea ◽  
Stem Diameter ◽  
Breaking Point ◽  
Stem Strength ◽  
Pisum Sativum L

We assessed genetic variation in stem strength in field pea (Pisum sativum L.) using physical and biological measures in order to develop selection criteria for breeding programs. A diverse group of 6 pea genotypes was subjected to 2 levels of disease (ascochyta leaf and stem blight), high and low. Stem samples were tested for physical stem strength (load at breaking point and flexion) using a universal testing machine. Stem diameter and compressed stem thickness were measured as biological indicators of stem strength. The genotypes varied significantly in physical and biological measures of stem strength, and in resistance to ascochyta blight. Load at breaking point was strongly associated with compressed stem thickness but only weakly associated with stem diameter. Significant variation in compressed stem thickness was present among pea genotypes, supporting this as an inexpensive, reliable, and quantitative measure for use in the field. There was no variation in stem lignin content among genotypes. Ascochyta blight resistance and stem strength, as assessed by load, flexion, or compressed stem thickness, were independent traits (the main effects of disease level and genotype × disease level interactions for load, flexion, and compressed stem thickness were non-significant). Therefore, concurrent genetic gains in both ascochyta resistance and stem strength should be possible in the same pea breeding population.

Predicting regional-scale spread of ascospores of Didymella pinodes causing ascochyta blight disease on field pea

2011 ◽  
Vol 40 (6) ◽  
pp. 640-647 ◽  
Author(s):  
Moin U. Salam ◽  
Jean Galloway ◽  
Art J. Diggle ◽  
William J. MacLeod ◽  
Tim Maling
Keyword(s):  
Ascochyta Blight ◽  
Regional Scale ◽  
Field Pea ◽  
Didymella Pinodes ◽  
Blight Disease

Pinolide, a New Nonenolide Produced by Didymella pinodes, the Causal Agent of Ascochyta Blight on Pisum sativum

2012 ◽  
Vol 60 (21) ◽  
pp. 5273-5278 ◽  
Author(s):  
Alessio Cimmino ◽  
Anna Andolfi ◽  
Sara Fondevilla ◽  
Mohamed A. Abouzeid ◽  
Diego Rubiales ◽  
...  
Keyword(s):  
Pisum Sativum ◽  
Ascochyta Blight ◽  
Causal Agent ◽  
Didymella Pinodes

scholarly journals Cryptic diversity found in Didymellaceae from Australian native legumes

MycoKeys ◽  
2021 ◽  
Vol 78 ◽  
pp. 1-20
Author(s):  
Elizabeth C. Keirnan ◽  
Yu Pei Tan ◽  
Matthew H. Laurence ◽  
Allison A. Mertin ◽  
Edward C. Y. Liew ◽  
...  
Keyword(s):  
Rna Polymerase Ii ◽  
Leaf Spot ◽  
Novel Species ◽  
Phylogenetic Analyses ◽  
Ascochyta Blight ◽  
South Australia ◽  
Field Pea ◽  
Internal Transcribed Spacer Region ◽  
New Host ◽  
Didymella Pinodes

Ascochyta koolunga (Didymellaceae, Pleosporales) was first described in 2009 (as Phoma koolunga) and identified as the causal agent of Ascochyta blight of Pisum sativum (field pea) in South Australia. Since then A. koolunga has not been reported anywhere else in the world, and its origins and occurrence on other legume (Fabaceae) species remains unknown. Blight and leaf spot diseases of Australian native, pasture and naturalised legumes were studied to investigate a possible native origin of A. koolunga. Ascochyta koolunga was not detected on native, naturalised or pasture legumes that had leaf spot symptoms, in any of the studied regions in southern Australia, and only one isolate was recovered from P. sativum. However, we isolated five novel species in the Didymellaceae from leaf spots of Australian native legumes from commercial field pea regions throughout southern Australia. The novel species were classified on the basis of morphology and phylogenetic analyses of the internal transcribed spacer region and part of the RNA polymerase II subunit B gene region. Three of these species, Nothophoma garlbiwalawardasp. nov., Nothophoma naiawusp. nov. and Nothophoma ngayawangsp. nov., were isolated from Senna artemisioides. The other species described here are Epicoccum djirangnandirisp. nov. from Swainsona galegifolia and Neodidymelliopsis tinkyukukusp. nov. from Hardenbergia violacea. In addition, we report three new host-pathogen associations in Australia, namely Didymella pinodes on S. artemisioides and Vicia cracca, and D. lethalis on Lathyrus tingitanus. This is also the first report of Didymella prosopidis in Australia.

Sign in / Sign up

Export Citation Format

Share Document