scholarly journals Detection and phylogeny of viruses in native Albanian olive varieties

2021 ◽  
Vol 60 (1) ◽  
pp. 165-174
Author(s):  
Toufic ELBEAINO ◽  
Magdalena CARA ◽  
Shpend SHAHINI ◽  
Pasko PANDELI
Keyword(s):  
Mosaic Virus ◽  
Leaf Roll ◽  
Olive Tree ◽  
Ringspot Virus ◽  
Arabis Mosaic Virus ◽  
Cherry Leaf Roll Virus ◽  
Leaf Yellowing ◽  
Standard Quality ◽  
Olive Trees ◽  
Olive Varieties

Forty samples representing 14 native Albanian and two foreign olive varieties were collected from an olive varietal collection plot in the Valias region (Tirana, Albania). The samples were assayed by RT-PCR for presence of olive-infecting viruses, including arabis mosaic virus (ArMV), cherry leaf roll virus (CLRV), cucumber mosaic virus (CMV), olive latent ringspot virus (OLRSV), olive latent virus 1 (OLV-1), olive leaf yellowing-associated virus (OLYaV), strawberry latent ringspot virus (SLRSV) and by PCR for the bacterium Xylella fastidiosa (Xf). Ninety-eight percent of the samples were infected with at least one virus. OLYaV was the most prevalent (85% of samples), followed by OLV-1 (50%), OLRSV (48%), CMV (28%), SLRSV (3%) and CLRV (5%), whereas ArMV and Xf were absent. Fifty-five percent of the samples were infected with one virus, 13% with two viruses, 20% with three, and 5% with four. Analyses of the nucleotide sequences of the Albanian virus isolates generally showed low genetic variability, and that most were phylogenetically related to Mediterranean isolates, in particular to those from Greece and Italy. Five olive trees, representing three native cultivars (‘Managiel’, ‘Kalinjot’ and ‘Kushan-Preze’) and one foreign (‘Leccino’), were found to be plants of the Conformitas Agraria Communitatis (“CAC”) category i.e. free of ArMV, CLRV, SLRSV and OLYaV. Only one tree of the native cultivar ‘Ulliri i kuq’ was free of all tested viruses, so this is plant material of the “Virus-tested” category. Olives derived from both categories could be used for propagation of standard quality plant materiel in a future certification programme for olive in Albania. This is the first report of CLRV, OLRSV, CMV and OLV-1 in Albania. The study also reveals the precarious health status of native olive varieties in the Valias varietal collection plot. However, the discovery of six plants representing two certifiable categories is a first step in a future olive tree certification program in the country.

scholarly journals Virus Surveys in Olive Orchards in Greece Identify Olive Virus T, a Novel Member of the Genus Tepovirus

Pathogens ◽  
2021 ◽  
Vol 10 (5) ◽  
pp. 574
Author(s):  
Evanthia Xylogianni ◽  
Paolo Margaria ◽  
Dennis Knierim ◽  
Kyriaki Sareli ◽  
Stephan Winter ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Leaf Roll ◽  
Virus Infections ◽  
Northern Greece ◽  
Coat Protein Region ◽  
Cherry Leaf Roll Virus ◽  
Leaf Yellowing ◽  
Olive Trees ◽  
Olive Varieties ◽  
Viral Sequences

Field surveys were conducted in Greek olive orchards from 2017 to 2020 to collect information on the sanitary status of the trees. Using a high-throughput sequencing approach, viral sequences were identified in total RNA extracts from several trees and assembled to reconstruct the complete genomes of two isolates of a new viral species of the genus Tepovirus (Betaflexiviridae), for which the name olive virus T (OlVT) is proposed. A reverse transcription–polymerase chain reaction assay was developed which detected OlVT in samples collected in olive growing regions in Central and Northern Greece, showing a virus prevalence of 4.4% in the olive trees screened. Sequences of amplified fragments from the movement–coat protein region of OlVT isolates varied from 75.64% to 99.35%. Three olive varieties (Koroneiki, Arbequina and Frantoio) were infected with OlVT via grafting to confirm a graft-transmissible agent, but virus infections remained latent. In addition, cucumber mosaic virus, olive leaf yellowing-associated virus and cherry leaf roll virus were identified.

scholarly journals First Report of a Disease of Peony Caused by Alfalfa mosaic virus

Plant Disease ◽  
2003 ◽  
Vol 87 (1) ◽  
pp. 99-99 ◽  
Author(s):  
M. G. Bellardi ◽  
C. Rubies-Autonell ◽  
A. Bianchi
Keyword(s):  
Mosaic Virus ◽  
Leaf Roll ◽  
Tobacco Rattle Virus ◽  
Alfalfa Mosaic Virus ◽  
Ringspot Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
First Report ◽  
Systemic Leaf ◽  
Cherry Leaf Roll Virus ◽  
Line Patterns

During the summers of 2001 and 2002, Japanese peony (Paeonia albiflora Pall., synonym P. lactiflora, family Paeoniaceae) plants, cultivated in the Botanical Garden of the University of Parma (Emilia Romagna Region of northern Italy), were found affected by a disease with virus-like symptoms. The oldest leaves showed yellow, mosaic, oak-like arabesques and line-patterns; the remaining leaves and pink flowers were symptomless. A disease of peony, known as peony ring spot disease, has been reported worldwide (Europe, United States, Japan, and New Zeland) for several years and is associated with strains of Tobacco rattle virus (TRV) (1). Electron microscopic observations of peony leaf sap (leaf dip preparations stained with uranyl acetate and phospotungstic acid) did not show the presence of any rod-shaped virus particles, including TRV. Mechanical inoculations of sap from symptomatic leaves caused symptoms typical of Alfalfa mosaic virus (AMV) on Chenopodium amaranticolor Coste & Reyn. (local chlorotic and necrotic lesions and systemic periveinal line-patterns), Ocimum basilicum L. (yellow mosaic), Vigna unguiculata (L.) Walp. (red, local necrotic lesions), and Nicotiana tabacum cv. Samsun (white, necrotic lesions, systemic leaf malformation, and mosaic), and N. glutinosa L. (systemic leaf variegation). Symptomatic leaves of peony and infected herbaceous plants were analyzed for virus presence by protein A sandwich enzyme-linked immunosorbent assay (PAS-ELISA). The polyclonal antisera tested were those to AMV (PVAS 92, American Type Culture Collection, Manassas, VA), AMV-Vinca minor L. (DiSTA collection, Italy), and the nepoviruses Strawberry latent ringspot virus, Tomato ringspot virus, and Cherry leaf roll virus. PAS-ELISA revealed only the presence of AMV. Immunoelectron microscopy and gold-labeled decoration confirmed the identity of the virus. In 2001, five symptomless peony plants (provided by a commercial grower and previously analyzed for AMV and TRV presence) were grafted with shoots from peony showing yellow mosaic on the leaves and maintained in a greenhouse under aphid-proof cage. During the summer of 2002, one of the grafted plants showed a mild mosaic on the leaves; PAS-ELISA revealed this peony was infected by AMV. To our knowledge, this is the first report of AMV in peony. Reference: (1) Chang et al. Ann. Phytopathol. Soc. Jpn. 42:325, 1976.

Identification of Two Tobacco rattle virus Sequence Variants Associated with Virus-like Mottle Symptom on Hosta in Ohio

2013 ◽  
Vol 14 (1) ◽  
pp. 24 ◽  
Author(s):  
John R. Fisher
Keyword(s):  
Mosaic Virus ◽  
Tobacco Rattle Virus ◽  
Alfalfa Mosaic Virus ◽  
Pcr Primers ◽  
Ringspot Virus ◽  
Impatiens Necrotic Spot Virus ◽  
Sequence Variants ◽  
Arabis Mosaic Virus ◽  
Specific Pcr ◽  
Wilt Virus

Two Hosta sp. ‘So Sweet’ plants and one Hosta sieboldii (labeled as ‘Albo-marginata’) plant showing a suspected virus-like leaf mottle symptom tested negative for the Potyvirus group, Hosta virus X, Alfalfa mosaic virus, Arabis mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato ringspot virus, and Tomato spotted wilt virus by ELISA. DsRNA analysis produced a banding profile suggestive of a viral infection, and dsRNA was used as template to synthesize cDNAs for use with tobravirus group and Tobacco rattle virus (TRV) specific PCR primers. Amplicons were cloned and sequenced, and results showed two distinct populations of sequences: the two So Sweet isolates were ∼99% identical to each other but only ∼92% identical to the Albo-marginata isolate. These results represent the first confirmed report of TRV in Hosta in Ohio, and further demonstrate that there are at least two nucleotide sequence variants of the virus infecting Ohio Hosta. Accepted for publication 21 December 2012. Published 30 March 2013.

scholarly journals Occurrence of Stone Fruit Viruses in Plum Orchards in Latvia

2013 ◽  
Vol 67 (2) ◽  
pp. 116-123
Author(s):  
Alina Gospodaryk ◽  
Inga Moročko-Bičevska ◽  
Neda Pūpola ◽  
Anna Kāle
Keyword(s):  
Mosaic Virus ◽  
Large Scale ◽  
Ringspot Virus ◽  
Stone Fruit ◽  
Detection Methods ◽  
Plum Pox Virus ◽  
Rt Pcr ◽  
Detection Rates ◽  
Arabis Mosaic Virus ◽  
Das Elisa

To evaluate the occurrence of nine viruses infecting Prunus a large-scale survey and sampling in Latvian plum orchards was carried out. Occurrence of Apple mosaic virus (ApMV), Prune dwarf virus (PDV), Prunus necrotic ringspot virus (PNRSV), Apple chlorotic leaf spot virus (ACLSV), and Plum pox virus (PPV) was investigated by RT-PCR and DAS ELISA detection methods. The detection rates of both methods were compared. Screening of occurrence of Strawberry latent ringspot virus (SLRSV), Arabis mosaic virus (ArMV), Tomato ringspot virus (ToRSV) and Petunia asteroid mosaic virus (PeAMV) was performed by DAS-ELISA. In total, 38% of the tested trees by RT-PCR were infected at least with one of the analysed viruses. Among those 30.7% were infected with PNRSV and 16.4% with PDV, while ApMV, ACLSV and PPV were detected in few samples. The most widespread mixed infection was the combination of PDV+PNRSV. Observed symptoms characteristic for PPV were confirmed with RT-PCR and D strain was detected. Comparative analyses showed that detection rates by RT-PCR and DAS ELISA in plums depended on the particular virus tested. The results obtained in this study revealed that commonly grown plum cultivars in Latvia are infected with economically important stone fruit viruses and highlight the need to implement a programme to produce and propagate virus-free planting material.

scholarly journals Olive Varieties under UV-B Stress Show Distinct Responses in Terms of Antioxidant Machinery and Isoform/Activity of RubisCO

2021 ◽  
Vol 22 (20) ◽  
pp. 11214
Author(s):  
Chiara Piccini ◽  
Giampiero Cai ◽  
Maria Celeste Dias ◽  
Márcia Araújo ◽  
Sara Parri ◽  
...  
Keyword(s):  
Sucrose Synthase ◽  
Olive Tree ◽  
Progressive Increase ◽  
Comprehensive Picture ◽  
Biochemical Level ◽  
Antioxidant Defense Systems ◽  
Olive Trees ◽  
Olive Varieties ◽  
Consequent Increase ◽  
High Adaptation

In recent decades, atmospheric pollution led to a progressive reduction of the ozone layer with a consequent increase in UV-B radiation. Despite the high adaptation of olive trees to the Mediterranean environment, the progressive increase of UV-B radiation is a risk factor for olive tree cultivation. It is therefore necessary to understand how high levels of UV-B radiation affect olive plants and to identify olive varieties which are better adapted. In this study we analyzed two Italian olive varieties subjected to chronic UV-B stress. We focused on the effects of UV-B radiation on RubisCO, in terms of quantity, enzymatic activity and isoform composition. In addition, we also analyzed changes in the activity of antioxidant enzymes (SOD, CAT, GPox) to get a comprehensive picture of the antioxidant system. We also evaluated the effects of UV-B on the enzyme sucrose synthase. The overall damage at biochemical level was also assessed by analyzing changes in Hsp70, a protein triggered under stress conditions. The results of this work indicate that the varieties (Giarraffa and Olivastra Seggianese) differ significantly in the use of specific antioxidant defense systems, as well as in the activity and isoform composition of RubisCO. Combined with a different use of sucrose synthase, the overall picture shows that Giarraffa optimized the use of GPox and opted for a targeted choice of RubisCO isoforms, in addition to managing the content of sucrose synthase, thereby saving energy during critical stress points.

scholarly journals Features of the strawberry field repository formation

2021 ◽  
Vol 22 (5) ◽  
pp. 715-724
Author(s):  
M. T. Upadyshev ◽  
T. A. Tumaeva ◽  
A. A. Borisova ◽  
N. V. Andronova ◽  
A. D. Petrova ◽  
...  
Keyword(s):  
Mosaic Virus ◽  
High Efficiency ◽  
International Standards ◽  
Ringspot Virus ◽  
Fruit Crops ◽  
Arabis Mosaic Virus ◽  
Planting Material ◽  
Intact Plants ◽  
Small Fruit ◽  
Horticultural Research

For the successful functioning of a breeding and nursery center of scientific and practical work with fruit and small fruit crops, an important task is to create repositories, including thosein the field. A field repository is a plant gene bank based in accordance with international standards on planting material that is free from dangerous pathogens, including viruses, representing tested for productivity typical plants.For the purpose of a comparative study of promising varieties, hybrids and clones-candidates for original plants, a field repository and mother plantation of strawberries clones and varieties have been created on the territory of the Federal Horticultural Research Center for Breeding, Agrotechnology and Nursery.As a result of research in 2015-2020, 386 high-yielding strawberry plants were selected and tested for the main harmful viruses using diagnostic kits from “Loewe” firm (Germany). The prevalence of harmful Arabis mosaic virus (ArMV), Raspberry ringspot virus (RpRSV), Tomato black ring virus (TBRV), Strawberry latent ringspot virus (SLRSV), Cucumber mosaic virus (CMV) in strawberry plantations depended on the area cultivation, varietal composition of plantings and ranged from 31 to 69 %. The prevalence of viruses RpRSV (up to 36 %), TBRV (up to 31 %) and CMV (up to 22 %) was established. The high efficiency of dry-air thermotherapy for the recovery of strawberries with the number of virus-free intact plants of 56 % has been shown.A genebank of "candidates for original plants" has been formed from 234 strawberry plants of 39 varieties and hybrids, which, after confirming their status by PCR, will be transferred to the category of "original plants".

scholarly journals Localization of Transmissible and Nontransmissible Viruses in the Vector Nematode Xiphinema americanum

2002 ◽  
Vol 92 (6) ◽  
pp. 646-653 ◽  
Author(s):  
Shouhua Wang ◽  
Rose C. Gergerich ◽  
Sandra L. Wickizer ◽  
Kyung S. Kim
Keyword(s):  
Electron Microscopy ◽  
Leaf Roll ◽  
Transmission Efficiency ◽  
Ringspot Virus ◽  
Nematode Population ◽  
Virus Like Particles ◽  
Food Canal ◽  
Cherry Leaf Roll Virus ◽  
The Status ◽  
Section Electron

The inner lining of the food canal of nematodes that transmit plantinfecting viruses is regarded as the retention region of viruses. To characterize the location of transmissible and nontransmissible viruses in the vector nematode Xiphinema americanum, three nepoviruses, Tobacco ringspot virus (TRSV), Tomato ringspot virus(TomRSV), and Cherry leaf roll virus(CLRV), and one non-nematode-transmissible virus, Squash mosaic virus (SqMV), were evaluated for transmission efficiency and localization sites in the nematode. Transmission trials showed highest transmission efficiency for TomRSV (38% with 1 and 100% with 10 nematodes, respectively), intermediate efficiency for TRSV (27% with 1 and 65% with 10 nematodes, respectively), and no transmission for CLRV and SqMV. Electron microscopy and immunofluorescent labeling revealed that TRSV was primarily localized to the lining of the lumen of the stylet extension and the anterior esophagus, but only rarely in the triradiate lumen. Within a nematode population, particles of TRSV were no longer observed in these three regions 10 weeks after acquisition, and it is assumed that there was gradual and random loss of the virus from these areas. The percentage of nematodes that were labeled by virus-specific immunofluorescent labeling in a population of viruliferous nematodes decreased gradually after TRSV acquisition when the nematodes were placed on a nonhost of the virus, and the loss of immunofluorescent labeling paralleled the decrease in the ability of the nematode population to transmit the virus. TomRSV was localized only in the triradiate lumen based on thin-section electron microscopy. No virus-like particles were observed in any part of the food canal of nematodes that had fed on CLRV-infected plants. Virus-like particles that appeared to be partially degraded were observed only in the triradiate lumen of nematodes that had fed on SqMV-infected plants. These results clarified the status of localization of two nontransmissible viruses in X. americanum and presented evidence that two nematode-transmissible viruses, TRSV and TomRSV, are localized in different regions of the food canal of X. americanum.

scholarly journals Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1067-1067 ◽  
Author(s):  
K. C. Eastwell ◽  
W. E. Howell
Keyword(s):  
Mosaic Virus ◽  
Sweet Cherry ◽  
The United States ◽  
Ringspot Virus ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Fresh Market ◽  
Arabis Mosaic Virus ◽  
Leafroll Virus ◽  
Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

Sign in / Sign up

Export Citation Format

Share Document