scholarly journals Identification of the Begomoviruses Squash Leaf Curl Virus and Watermelon Chlorotic Stunt Virus in Various Plant Samples in North America

Viruses ◽  
2021 ◽  
Vol 13 (5) ◽  
pp. 810
Author(s):  
Rafaela S. Fontenele ◽  
Amulya Bhaskara ◽  
Ilaria N. Cobb ◽  
Lucas C. Majure ◽  
Andrew M. Salywon ◽  
...  
Keyword(s):  
North America ◽  
High Throughput Sequencing ◽  
Essential Feature ◽  
Native Vegetation ◽  
Bipartite Begomovirus ◽  
Squash Leaf Curl Virus ◽  
The Usa ◽  
Leaf Curl Virus ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Geminiviruses are a group of plant-infecting viruses with single-stranded DNA genomes. Within this family, viruses in the genus Begomovirus are known to have a worldwide distribution causing a range of severe diseases in a multitude of dicotyledonous plant species. Begomoviruses are transmitted by the whitefly Bemisia tabaci, and their ssDNA genomes can be either monopartite or bipartite. As part of a viral survey, various plants including those in the families Alliaceae, Amaranthaceae, Apiaceae, Asteraceae, Brassicaceae, Cactaceae, Cucurbitaceae, Lamiaceae, Lauraceae, Malvaceae, Oleaceae and Solanaceae were sampled and screened for begomoviruses using both a high-throughput sequencing and a begomovirus-specific primer pair approach. Based on the sequences derived using these approaches, the full-length genome of various begomoviruses were amplified from plants using abutting primers. Squash leaf curl virus (SLCV) and watermelon chlorotic stunt virus (WCSV) were identified in Cactaceae (n = 25), Solanaceae (n = 7), Cucurbitaceae (n = 2) and Lamiaceae (n = 1) samples. WCSV is an Old World bipartite begomovirus that has only recently been discovered infecting watermelons in the Americas. Our discovery of WCSV in the USA is the first indication that it has reached this country and indicates that this virus might be widespread throughout North America. Phylogenetic analysis suggests WCSV was introduced to the New World twice. The detection of begomoviruses in cactus plants suggests possible spillover events from agricultural areas into native vegetation. Since WCSV and SLCV have previously been found in mixed infections, pseudo-recombination infection experiments were conducted. We demonstrate that WCSV DNA-B is successfully trans-replicated by SLCV DNA-A despite very low degree of similarity between the replication-associated iterative sequences present in their common region, an essential feature for binding of the replication associated protein. This study highlights the importance of viral surveys for the detection of spillover events into native vegetation, but also suggests the need for more surveillance of WCSV in the USA, as this virus is a serious threat to watermelon cultivation in the Middle East.

scholarly journals Characterization of a Synergistic Interaction Between Two Cucurbit-Infecting Begomoviruses: Squash leaf curl virus and Watermelon chlorotic stunt virus

2011 ◽  
Vol 101 (2) ◽  
pp. 281-289 ◽  
Author(s):  
Tali Sufrin-Ringwald ◽  
Moshe Lapidot
Keyword(s):  
Eastern Mediterranean ◽  
Dual Infection ◽  
Synergistic Interaction ◽  
Bipartite Begomoviruses ◽  
Disease Symptoms ◽  
Squash Leaf Curl Virus ◽  
Effect On Yield ◽  
Leaf Curl Virus ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Squash leaf curl virus (SLCV) and Watermelon chlorotic stunt virus (WmCSV) are cucurbit-infecting bipartite begomoviruses. Both viruses are found in the eastern Mediterranean basin but the effects of dual infection of both viruses on melon (Cucumis melo L.) have not been described. ‘Arava’ melon plants were inoculated in the greenhouse, using whiteflies, with either SLCV, WmCSV, or both. Control plants were exposed to nonviruliferous whiteflies or not exposed at all. Following inoculation, plants were transplanted to a 50-mesh insect-proof nethouse and grown until fruit maturity. The experiment was performed in two melon-growing seasons: spring, transplant in May and harvest in July; and summer, transplant in August and harvest in October. Following inoculation, SLCV-infected melon plants showed mild symptoms that disappeared with time, and there was no effect on plant height. WmCSV-infected plants developed disease symptoms that became more obvious with time, and plants were somewhat shorter than control plants in the spring but not in the summer. SLCV had no effect on yield, regardless of season. WmCSV had no statistically significant effect on yield in the spring but, in the summer, reduced yield by 22%, on average. Dual-inoculated plants showed a synergistic interaction between the two viruses. They developed disease symptoms that were more pronounced than WmCSV alone, with plants being shorter than control plants by 20 to 25% regardless of season. Moreover, the yield of dual-inoculated plants was reduced on average by 21% in the spring and 54% in the summer, and fruit appearance was adversely affected. Dual inoculation did not affect WmCSV DNA level but SLCV DNA level was increased several-fold by the presence of WmCSV.

scholarly journals Cucurbit leaf curl virus, a New Whitefly Transmitted Geminivirus in Arizona, Texas, and Mexico

Plant Disease ◽  
2000 ◽  
Vol 84 (7) ◽  
pp. 809-809 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris ◽  
M. W. Olsen ◽  
M. E. Miller ◽  
T. Isakeit ◽  
...  
Keyword(s):  
Binding Site ◽  
Field Isolate ◽  
Bipartite Begomovirus ◽  
Degenerate Primers ◽  
Field Isolates ◽  
Squash Leaf Curl Virus ◽  
Cp Gene ◽  
Honeydew Melon ◽  
Leaf Curl Virus ◽  
Leaf Curl

In 1998 to 1999, geminivirus-like symptoms were observed in whitefly-infested pumpkin, honeydew melon, and muskmelon in Arizona and Texas and in Coahuilla, Mexico (MX), respectively. Plants exhibited leaf curl and/or mottling, reminiscent of symptoms caused by Squash leaf curl virus (SLCV-WAZ) described from Arizona in 1981 (2). The isolate from Arizona pumpkin fields was experimentally transmitted to pumpkin seedlings by the “B type” of Bemisia tabaci (Genn.), and symptoms were indistinguishable from those observed in infected fields. Samples from AZ, MX, and TX were assessed for begomovirus presence by polymerase chain reaction (PCR) using degenerate primers that amplify a contiguous fragment containing the viral coat protein (Cp) gene and common region (CR) of the A component (CR-A) (~2,100 bp) and a fragment containing the CR of the B component (CR-B) (~1,100 bp). One to four isolates from each location were examined by PCR using both primer pairs, and at least three amplicons per isolate were cloned and their sequences determined. Alignment of viral Cp nucleotide (nt) sequences revealed that AZ [AF256199], MX, and TX field isolates shared 98.7 to 100% sequence identity, but were only 84.5 to 85.6% identical to the Cp gene of SLCV-extended (SLCV-E) [M38183] and SLCV-restricted (SLCV-R) (S. G. Lazarowitz, unpublished), respectively, suggesting a new, previously undescribed begomoviral species (3). Further, the Cp nt sequence of the three field isolates was 6 nt shorter than SLCV-E, SLCV-WAZ [AF256203], and SLCV-R Cp sequences. The CR-A [AF256200] and CR-B [AF256201] sequences (179 nt, each) of field isolates, including the theoretical Rep binding element, GGTGT, were 100% identical. Although the Rep binding site is identical among field isolates, SLCV-E, SLCV-R, and SLCV-WAZ, the field isolate CR sequence shared only 64.2, 67.5, and 66.9% overall identity with CR-A SLCV-E, SLCV-R [M63155], and SLCV-WAZ [AF256202], respectively. Prior to 1998 to 1999, SLCV-WAZ was the only New World begomovirus of cucurbits known to infect both melon (Cucumis) and pumpkin (Cucurbita) (1). Therefore, SLCV was initially suspected as the causal agent. However, here we provide evidence for a new, previously undescribed bipartite begomovirus of cucurbits in AZ, MX, and TX that is herein provisionally designated Cucurbit leaf curl virus (CuLCV). Prediction of its closest begomovirus relatives by Cp nt sequence and Rep binding site comparisons suggest that CuLCV is a new member of the SLCV lineage, also containing Bean calico mosaic virus, Cabbage leaf curl virus, SLCV-E, and Texas pepper virus-TAM. References: (1) J. K. Brown and M. R. Nelson. Phytopathology 74:1136, 1984. (2) J. K. Brown and M. R. Nelson. Ann. Appl. Biol. 115:243, 1986. (3) M. A. Mayo and C. R. Pringle. J. Gen. Virol. 97:649, 1998.

scholarly journals Squash Leaf Curl Virus: A New World Bipartite Begomovirus Threatening Squash Production in Oman

Plant Disease ◽  
2020 ◽  
Vol 104 (9) ◽  
pp. 2533-2533
Author(s):  
M. S. Shahid ◽  
H. Al-Sulaimani ◽  
A. M. Al-Sadi
Keyword(s):  
New World ◽  
Bipartite Begomovirus ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals First Report on the Association of Squash leaf curl virus and Watermelon chlorotic stunt virus with Tomato Yellow Leaf Curl Disease

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 428-428 ◽  
Author(s):  
F. Haj Ahmad ◽  
W. Odeh ◽  
G. Anfoka
Keyword(s):  
Tomato Yellow Leaf ◽  
Virus Species ◽  
Yellow Leaf ◽  
First Report ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Symptomatic Plant ◽  
Mexican Isolate ◽  
Watermelon Chlorotic Stunt Virus ◽  
Leaf Curl

Tomato (Solanum lycopersicum Mill.) is one of the most economically important vegetable crops in Jordan. Tomato cultivation in many countries in the Mediterranean basin is affected by several virus species belonging to Tomato yellow leaf curl virus complex (3). In March 2011, a field experiment was conducted at Horet Al-Sahen region to screen tomato breeding lines for resistance against TYLCD. Unexpectedly, severe TYLCD symptoms, including leaf curling, yellowing, and severe stunting were observed on some plants belonging to the F5 generation of a breeding line that was supposed to be resistant to the virus. One symptomatic plant was transferred into the greenhouse and used for whitefly transmission. The virus isolate was maintained on a susceptible tomato landrace by serial transmission using biotype B of the whitely vector (Bemisia tabaci). To confirm begomovirus infections, total nucleic acids were extracted from leaf tissues as previously described (4) and viral DNA genomes were amplified by rolling circle amplification (RCA) using the TempliPhi Amplification Kit (GE Healthcare). RCA products were then subjected to restriction digestion with different enzymes. Two DNA fragments of 1,035 bp and 1,760 bp were the products of EcoRl-digestion. Following sequencing, BLASTn analysis showed that the small fragment (1,035 bp) (GenBank Accession No. JX444576) corresponding to nts 2,408 to 2,690 of Watermelon chlorotic stunt virus from Jordan (WmCSV-[JO]) (EU561237) had approximately 99% nt identity with WmCSV-[JO] and other isolates from Israel (EF201809) and Iran (AJ245652), while the second fragment (1,760 bp) which corresponds to nts 117 to 1,877 of TYLCV genome had 98% nt identities with the Mexican isolate of TYLCV (FJ609655). Two pairs of primers (TYLCV29F1: TATGGCAATCGGTGTATC/TYLCV29R1: GTGTCCAGGTATAAGTAAG) and (TYLCV29F2: GAGAGCCCAATTTTTCAAG/TYLCV29R2: GGGAATATCTAGACGAAGAA) were used to amplify full TYLCV genome. Sequence analysis showed that TYLCV (JX444575) had the highest (98%) nt identity with the Mexican isolate of TYLCV (FJ609655). Because Squash leaf curl virus and WmCSV were recently reported in Jordan (1,2), we further investigated whether SLCV was also involved in the disease; therefore, two pairs of SLCV-specific primers (SLCVF-Sal (TATAGTCGACGTTGAACCGGATTTGAATG)/SLCVR-Sal (TATAGTCGACCTGAGGAGAGCACTAAATC) (DNA-A) and SLCVF-Hindlll (ATTAAAGCTTAGTGGTTATGCAAGGCG)/SLCVR-Hindlll (ATTAAAGCTTGGCTGCACCATATGAACG) (DNA-B) were used in PCR using RCA products as template. The expected sizes of DNA-A (2,639 bp) (JX444577) and DNA-B (2,607 bp) (JX444574) could successfully be amplified from the original symptomatic plant. Phylogenetic analysis showed that DNA-A was closely related to SLCV isolates from Lebanon (HM368373) and Egypt (DQ285019) with 99% nt identity, while DNA-B had highest nt identity (99%) with the Israeli isolate of SLCV (HQ184437). To our knowledge, this is the first report on the association of SLCV and WmCSV with TYLCD. Further studies will be carried out to investigate whether tomato can act as an inoculum source for these two viruses. References: (1) A. Al-Musa et al. J. Phytopath. 156:311, 2008 (2) A. Al-Musa et al. Virus Genes 43:79, 2011. (3) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (4) J. L. Potter et al. Plant Dis, 87:1205, 2003.

scholarly journals A New Tomato-Infecting Begomovirus in Barbados

Plant Disease ◽  
2000 ◽  
Vol 84 (12) ◽  
pp. 1342-1342 ◽  
Author(s):  
M. E. Roye ◽  
N. M. Henry ◽  
P. D. Burrell ◽  
W. A. McLaughlin ◽  
M. K. Nakhla ◽  
...  
Keyword(s):  
Plant Species ◽  
Western Hemisphere ◽  
Pairwise Comparisons ◽  
Bipartite Begomovirus ◽  
Weak Signals ◽  
Tomato Plants ◽  
Leaf Curling ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

In September 1998, tomato plants in Barbados exhibited symptoms of severe leaf curling without marginal chlorosis. These symptoms were often associated with an increase in whitefly (Bemisia tabaci) populations. DNA was extracted from leaf tissue from symptomatic tomato plants. Polymerase chain reaction (PCR) was performed with DNA-A degenerate primer pair PAC1v1978/PAV1c715, which amplifies part of the rep gene, the cp gene, and the common region (CR), and with DNA-B primer pair PBC1v2039/PBV1c800, which amplifies part of the bc1 and bv1 genes and the CR (2). The amplified PCR fragments of DNA-A and DNA-B were 1.3 and 1.4 kb, respectively, which are the expected sizes from bipartite, whitefly-transmitted geminiviruses of the Western Hemisphere (2). DNA sequence of the cloned fragments of DNA-A and DNA-B are available as GenBank No. AF213013 and AF213014, respectively. The 181 nucleotides of the CR of DNA-A had a nucleotide identity of 96% with the CR of DNA-B, which indicates that this is a bipartite begomovirus. Pairwise comparisons using DNASTAR (DNASTAR, Madison, WI) of the sequenced part of DNA-A was most similar to Cabbage leaf curl virus (CaLCuV, 69%, U65529) and Squash leaf curl virus extended host range isolate (SqLCV-E, 64%, M38183), and <59% to 13 other bipartite Western Hemisphere geminiviruses and Tomato yellow leaf curl virus from Israel (X15656). Pairwise comparisons of the DNA-B fragment sequence was 59 and 55% similar to CaLCuV (U65530) and SqLCV-E (M38182), respectively. Phylogenetic analysis of DNA-A of the major groups of Western Hemisphere begomoviruses placed the Barbados tomato-infecting geminivirus in the cluster with CaLCuV and SqLCV-E (1), while DNA-B analysis placed it with CaLCuV. The DNA-A amplified fragment was used as a probe at high stringency with the dot blot hybridization assay using the Genius II labeling and detection kit (Boeringer Mannheim) to detect this geminivirus in tomato and several other plant species, which had typical geminiviral symptoms. Strong hybridization signals were obtained for all 23 tomato plants with symptoms, weak signals were observed for two of three muskmelon and two of seven watermelon plants, all with leaf curling symptoms. No hybridization signals were observed for peppers with leaf curling symptoms and two weed species, Macroptilium lathyroides and Rhynchosia minima, with golden mosaic symptoms or with the symptomless plant species used as negative controls. The weak signals observed from watermelon and muskmelon samples indicated the presence of low virus titer or geminiviruses distinct from this tomato virus. The presence of viral DNA in these two plant species was confirmed by PCR with degenerate primers described above. Resulting database searches of sequences in the GenBank revealed that the Barbados tomato virus appears to be a previously unreported virus. This new virus is given the provisional name Tomato leaf curl Barbados virus (ToLCBBV). References: (1) J. C. Faria et al. Phytopathology 84:321, 1994. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

scholarly journals Use of Posttranscription Gene Silencing in Squash to Induce Resistance against the Egyptian Isolate of theSquash Leaf Curl Virus

2016 ◽  
Vol 2016 ◽  
pp. 1-9 ◽  
Author(s):  
Omnia Taha ◽  
Inas Farouk ◽  
Abdelhadi Abdallah ◽  
Naglaa A. Abdallah
Keyword(s):  
Gene Silencing ◽  
Real Time ◽  
Real Time Pcr ◽  
Protein Gene ◽  
Bipartite Begomovirus ◽  
Squash Leaf Curl Virus ◽  
Induce Resistance ◽  
Biotype B ◽  
Leaf Curl Virus ◽  
Leaf Curl

Squash leaf curl virus(SqLCV) is a bipartite begomovirus affecting squash plants. It is transmitted by whiteflyBemisia tabacibiotype B causing severe leaf curling, vein banding, and molting ending by stunting. In this study full-length genomic clone of SqLCV Egyptian isolated and posttranscriptional gene silencing (PTGS) has been induced to develop virus resistance. The Noubaria SqLCV has more than 95% homology with Jordon, Israel, Lebanon, Palestine, and Cairo isolates. Two genes fragment from SqLCV introduced in sense and antisense orientations using pFGC5049 vector to be expressed as hairpin RNA. The first fragment was 348 bp from replication associated protein gene (Rep). The second fragment was 879 bp representing the full sequence of the movement protein gene (BC1). Using real-time PCR, a silencing record of 97% has been recorded toRep/TrAPconstruct; as a result it has prevented the appearance of viral symptoms in most tested plants up to two months after infection, while construct containing theBC1gene scored a reduction in the accumulation of viral genome expression as appearing in real-time PCR results 4.6-fold giving a silencing of 79%, which had a positive effect on symptoms development in most tested plants.

scholarly journals First report of begomoviruses infecting Cucumis sativus L. in North America and identification of a proposed new begomovirus species

PeerJ ◽  
2020 ◽  
Vol 8 ◽  
pp. e9245
Author(s):  
Sarahi Sanchez-Chavez ◽  
Carlos Fernando Regla-Marquez ◽  
Zugey Elizabeth Cardenas-Conejo ◽  
Daniel Alejandro Garcia-Rodriguez ◽  
Sara Centeno-Leija ◽  
...  
Keyword(s):  
New Species ◽  
North America ◽  
High Throughput Sequencing ◽  
Evolutionary Relationship ◽  
Small Sample ◽  
Begomovirus Species ◽  
Economic Losses ◽  
Bipartite Begomovirus ◽  
First Report ◽  
Squash Leaf Curl Virus

Background Members of the Begomovirus genus are phytopathogens that infect dicotyledonous plants, producing economic losses in tropical and subtropical regions. To date, only seven species of begomoviruses (BGVs) infecting cucumber have been described. Most cucumber infections were reported in South Asia. In the Americas, begomoviral infections affecting cucumber are scarce; just one report of begomovirus has been described in South America. The presence of whitefly and typical symptoms of viral infections observed in a cucumber field in Colima, Mexico, suggested that plants in this field were affected by BGVs. Methods To identify the BGVs infecting cucumber, we performed a high-throughput sequencing and compared the assembled contigs against the GenBank nucleic acid sequence database. To confirm the presence of viruses in cucumber samples, we performed a PCR detection using specific oligonucleotides. We cloned and sequenced by Sanger method the complete genome of a potential new begomovirus. Begomovirus species demarcation was performed according to the International Committee on Taxonomy of Viruses. The evolutionary relationship of the new virus was inferred using phylogenetic and recombination analyses. Results We identified five species of begomovirus infecting plants in a field. None of these have been previously reported infecting cucumber. One of the five species of viruses here reported is a new begomovirus species. Cucumber chlorotic leaf virus, the new species, is a bipartite begomovirus that has distinctive features of viruses belonging to the squash leaf curl virus clade. Conclusions The findings here described represent the first report of begomoviral infection affecting cucumber plants in North America. Previous to this report, only seven begomovirus species have been reported in the world, here we found five species infecting cucumber plants in a small sample suggesting that cucumber is vulnerable to BGVs. One of these viruses is a new species of begomovirus which is the first begomovirus originally isolated from the cucumber. The findings of this report could help to develop strategies to fight the begomoviral infections that affect cucumber crops.

scholarly journals Emergence of a New Cucurbit-Infecting Begomovirus Species Capable of Forming Viable Reassortants with Related Viruses in the Squash leaf curl virus Cluster

2002 ◽  
Vol 92 (7) ◽  
pp. 734-742 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris ◽  
C. Alteri ◽  
Drake C. Stenger
Keyword(s):  
Nucleotide Sequence ◽  
Host Range ◽  
Nucleotide Sequence Identity ◽  
Begomovirus Species ◽  
Progeny Virus ◽  
Bipartite Begomovirus ◽  
Sequence Identity ◽  
Squash Leaf Curl Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

Cucurbit leaf curl virus (CuLCV), a whitefly-transmitted geminivirus previously partially characterized from the southwestern United States and northern Mexico, was identified as a distinct bipartite begomovirus species. This virus has near sequence identity with the previously partially characterized Cucurbit leaf crumple virus from California. Experimental and natural host range studies indicated that CuLCV has a relatively broad host range within the family Cucurbitaceae and also infects bean and tobacco. The genome of an Arizona isolate, designated CuLCV-AZ, was cloned and completely sequenced. Cloned CuLCV-AZ DNA A and B components were infectious by biolistic inoculation to pumpkin and progeny virus was transmissible by the whitefly vector, Bemisia tabaci, thereby completing Koch's postulates. CuLCV-AZ DNA A shared highest nucleotide sequence identity with Squash leaf curl virus-R (SLCV-R), SLCV-E, and Bean calico mosaic virus (BCaMV) at 84, 83, and 80%, respectively. The CuLCV DNA B component shared highest nucleotide sequence identity with BCaMV, SLCV-R, and SLCV-E at 71, 70, and 68%, respectively. The cis-acting begomovirus replication specificity element, GGTGTCCTGGTG, in the CuLCV-AZ origin of replication is identical to that of SLCV-R, SLCV-E, and BCaMV, suggesting that reassortants among components of CuLCV-AZ and these begomoviruses may be possible. Reassortment experiments in pumpkin demonstrated that both reassortants of CuLCV-AZ and SLCV-E A and B components were viable. However, for CuLCV-AZ and SLCV-R, only one reassortant (SLCV-R DNA A/CuLCV-AZ DNA B) was viable on pumpkin, even though the cognate component pairs of both viruses infect pumpkin. These results demonstrate that reassortment among sympatric begomovirus species infecting cucurbits are possible, and that, if generated in nature, could result in begomoviruses bearing distinct biological properties.

scholarly journals Multiple Introductions of the Old World Begomovirus Tomato yellow leaf curl virus into the New World

2007 ◽  
Vol 73 (21) ◽  
pp. 7114-7117 ◽  
Author(s):  
Siobain Duffy ◽  
Edward C. Holmes
Keyword(s):  
North America ◽  
New World ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Old World ◽  
Multiple Introductions ◽  
The Caribbean ◽  
Genomic Regions ◽  
Leaf Curl Virus ◽  
Leaf Curl

ABSTRACT A phylogenetic analysis of three genomic regions revealed that Tomato yellow leaf curl virus (TYLCV) from western North America is distinct from TYLCV isolated in eastern North America and the Caribbean. This analysis supports a second introduction of this Old World begomovirus into the New World, most likely from Asia.

Tomato yellow leaf curl virus (leaf curl).

2021 ◽  
Author(s):  
Henryk Czosnek
Keyword(s):  
Middle Eastern ◽  
Long Distance ◽  
Tomato Production ◽  
Tomato Seedlings ◽  
Caribbean Islands ◽  
The Usa ◽  
History Of ◽  
Leaf Curl Virus ◽  
Whitefly Vector ◽  
Leaf Curl

Abstract The wide global distribution of tomato crops and the dramatic outbreaks of the populations of the TYLCV vector, the whitefly Bemisia tabaci, led to a pandemic of this devastating disease. The virus probably arose in the Middle East between the 1930s and 1950s. Its global invasion began in the 1980s after the emergence of two strains: TYLCV-IL and TYLCV-Mld. The long-distance transportation of viruliferous whiteflies contaminating commercial shipments of tomato seedlings and ornamentals is probably the major reason for the virus pandemic (Caciagli, 2007). Sequence analyses allowed Lefeuvre et al. (2010) to trace the history of TYLCV spread. For instance, TYLCV-IL has invaded the Americas at least twice, once from the Mediterranean basin in 1992-1994 and once from Asia (a descendant of imported Middle Eastern TYLCV) in 1999-2003. As a result the estimated losses caused by TYLCV reached about 20% of tomato production in the USA, and 30-100% in the Caribbean Islands, Mexico, Central America and Venezuela. Therefore several countries (Australia, EU) have established severe quarantine measures to control the whitefly vector.

Sign in / Sign up

Export Citation Format

Share Document