scholarly journals A Diverse Virome of Leafroll-Infected Grapevine Unveiled by dsRNA Sequencing

Viruses ◽  
2020 ◽  
Vol 12 (10) ◽  
pp. 1142
Author(s):  
Mamadou L. Fall ◽  
Dong Xu ◽  
Pierre Lemoyne ◽  
Issam E. Ben Moussa ◽  
Carole Beaulieu ◽  
...  
Keyword(s):  
Interspecific Hybrid ◽  
Pinot Noir ◽  
Grapevine Cultivar ◽  
Sequencing Method ◽  
Hop Stunt Viroid ◽  
Multiple Virus ◽  
Leafroll Disease ◽  
Different Strains ◽  
Hybrid Cultivar ◽  
Rupestris Stem Pitting

Quebec is the third-largest wine grape producing province in Canada, and the industry is constantly expanding. Traditionally, 90% of the grapevine cultivars grown in Quebec were winter hardy and largely dominated by interspecific hybrid Vitis sp. cultivars. Over the years, the winter protection techniques adopted by growers and climate changes have offered an opportunity to establish V. vinifera L. cultivars (e.g., Pinot noir). We characterized the virome of leafroll-infected interspecific hybrid cultivar and compared it to the virome of V. vinifera cultivar to support and facilitate the transition of the industry. A dsRNA sequencing method was used to sequence symptomatic and asymptomatic grapevine leaves of different cultivars. The results suggested a complex virome in terms of composition, abundance, richness, and phylogenetic diversity. Three viruses, grapevine Rupestris stem pitting-associated virus, grapevine leafroll-associated virus (GLRaV) 3 and 2 and hop stunt viroid (HSVd) largely dominated the virome. However, their presence and abundance varied among grapevine cultivars. The symptomless grapevine cultivar Vidal was frequently infected by multiple virus and viroid species and different strains of the same virus, including GLRaV-3 and 2. Our data show that viruses and viroids associated with the highest number of grapevines expressing symptoms included HSVd, GLRaV-3 and GLRaV-2, in gradient order. However, co-occurrence analysis revealed that the presence of GLRaV species was randomly associated with the development of virus-like symptoms. These findings and their implications for grapevine leafroll disease management are discussed.

scholarly journals A Diverse Virome of Leafroll-Infected Grapevine Unveil by dsRNA Sequencing

2020 ◽  
Author(s):  
Mamadou L. Fall ◽  
Dong Xu ◽  
Pierre Lemoyne ◽  
Issam E. Ben Moussa ◽  
Carole Beaulieu ◽  
...  
Keyword(s):  
Interspecific Hybrid ◽  
Pinot Noir ◽  
Grapevine Cultivar ◽  
Sequencing Method ◽  
Hop Stunt Viroid ◽  
Multiple Virus ◽  
Leafroll Disease ◽  
Different Strains ◽  
Hybrid Cultivar ◽  
Rupestris Stem Pitting

Quebec is the third-largest wine grape producing province in Canada, and the industry is constantly expanding. Traditionally, 90% of the grapevine cultivars grown in Quebec were rustic or semi-rustic and largely dominated by winter hardy interspecific hybrid Vitis sp. cultivars. Over the years, the winter protection techniques adopted by growers and climate changes have offered an opportunity to establish V. vinifera L. cultivars (e.g. Pinot Noir). We characterized the virome of leafroll-infected interspecific hybrid cultivar and compared it to the virome of V. vinifera cultivar to support and facilitate the transition of the industry. A dsRNA sequencing method was used to sequence symptomatic and asymptomatic grapevine leaves of different cultivars. The results suggested a complex virome in terms of composition, abundance, richness, and phylogenetic diversity. Three viruses, grapevine Rupestris stem pitting-associated virus, grapevine leafroll-associated virus (GLR) 3 and 2 and hop stunt viroid (HSVd) largely dominated the virome. However, their presence and abundance varied among grapevine cultivars. The symptomless grapevine cultivar Vidal was frequently infected by multiple virus and viroid species and different strains of the same virus, including GLR virus 3 and 2. Our data shows that viruses and viroids associated with the highest number of grapevines expressing symptoms included HSVd, GLR3 and GLR2, in gradient order. However, co-occurrence analysis revealed that the presence of GLR species was randomly associated with the development of virus-like symptoms. These findings and their implication for grapevine leafroll disease management were discussed.

scholarly journals A Diverse Virome of Leafroll-Infected Grapevine Unveil by dsRNA Sequencing

2020 ◽  
Author(s):  
Mamadou L. Fall ◽  
Dong Xu ◽  
Pierre Lemoyne ◽  
Issam E. Ben Moussa ◽  
Carole Beaulieu ◽  
...  
Keyword(s):  
Interspecific Hybrid ◽  
Pinot Noir ◽  
Grapevine Cultivar ◽  
Sequencing Method ◽  
Hop Stunt Viroid ◽  
Multiple Virus ◽  
Leafroll Disease ◽  
Different Strains ◽  
Hybrid Cultivar ◽  
Rupestris Stem Pitting

Quebec is the third-largest wine grape producing province in Canada, and the industry is constantly expanding. Traditionally, 90% of the grapevine cultivars grown in Quebec were rustic or semi-rustic and largely dominated by winter hardy interspecific hybrid Vitis sp. cultivars. Over the years, the winter protection techniques adopted by growers and climate changes have offered an opportunity to establish V. vinifera L. cultivars (e.g. Pinot Noir). We characterized the virome of leafroll-infected interspecific hybrid cultivar and compared it to the virome of V. vinifera cultivar to support and facilitate the transition of the industry. A dsRNA sequencing method was used to sequence symptomatic and asymptomatic grapevine leaves of different cultivars. The results suggested a complex virome in terms of composition, abundance, richness, and phylogenetic diversity. Three viruses, grapevine Rupestris stem pitting-associated virus, grapevine leafroll-associated virus (GLR) 3 and 2 and hop stunt viroid (HSVd) largely dominated the virome. However, their presence and abundance varied among grapevine cultivars. The symptomless grapevine cultivar Vidal was frequently infected by multiple virus and viroid species and different strains of the same virus, including GLR virus 3 and 2. Our data shows that viruses and viroids associated with the highest number of grapevines expressing symptoms included HSVd, GLR3 and GLR2, in gradient order. However, co-occurrence analysis revealed that the presence of GLR species was randomly associated with the development of virus-like symptoms. These findings and their implication for grapevine leafroll disease management were discussed.

scholarly journals Survey and Diversity of Grapevine Pinot gris virus in Algeria and Comprehensive High-Throughput Small RNA Sequencing Analysis of Two Isolates from Vitis vinifera cv. Sabel Revealing High Viral Diversity

Genes ◽  
2020 ◽  
Vol 11 (9) ◽  
pp. 1110
Author(s):  
Aleš Eichmeier ◽  
Eliška Peňázová ◽  
Jana Čechová ◽  
Akila Berraf-Tebbal
Keyword(s):  
Vitis Vinifera ◽  
Rna Sequencing ◽  
Small Rna ◽  
Phylogenetic Analyses ◽  
Small Rna Sequencing ◽  
Sequencing Analysis ◽  
Hop Stunt Viroid ◽  
Grapevine Virus B ◽  
Grapevine Pinot Gris Virus ◽  
Rupestris Stem Pitting

Grapevine Pinot gris virus (GPGV) is a putative causal agent of grapevine leaf mottling and deformation disease that has been reported worldwide throughout the grapevine-growing regions. Fifty-four grapevines collected from five Algerian grapevine-growing regions were tested for the presence of GPGV in phloem tissues. Eight of the tested grapevines were infected by GPGV. Viromes of two selected Vitis vinifera cv. Sabel grapevines infected by GPGV and showing virus-like symptoms were analyzed by small RNA sequencing. Phylogenetic analyses of the partial coding sequence (cds) of the RNA-dependent RNA polymerase (RdRp) domain showed that all Algerian GPGV isolates were grouped with some already-described asymptomatic isolates. This study provides the first survey of the occurrence of GPGV in Algeria. Moreover, Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine virus B, Grapevine rupestris vein feathering virus, Hop stunt viroid and Grapevine yellow speckle viroid 1 were detected in Algeria for the first time.

scholarly journals Physical mapping in highly heterozygous genomes: a physical contig map of the Pinot Noir grapevine cultivar

BMC Genomics ◽  
2010 ◽  
Vol 11 (1) ◽  
pp. 204 ◽  
Author(s):  
Simone Scalabrin ◽  
Michela Troggio ◽  
Marco Moroldo ◽  
Massimo Pindo ◽  
Nicoletta Felice ◽  
...  
Keyword(s):  
Physical Mapping ◽  
Pinot Noir ◽  
Grapevine Cultivar ◽  
Contig Map

scholarly journals Population sequencing reveals clonal diversity and ancestral inbreeding in the grapevine cultivar Chardonnay

2018 ◽  
Author(s):  
Michael J. Roach ◽  
Daniel L. Johnson ◽  
Joerg Bohlmann ◽  
Hennie J.J. van Vuuren ◽  
Steven J. M. Jones ◽  
...  
Keyword(s):  
Single Molecule ◽  
Genome Assembly ◽  
Clonal Selection ◽  
Pinot Noir ◽  
Genetic Mutations ◽  
Phenotypic Trait ◽  
Sequencing Data ◽  
High Quality ◽  
Asexual Propagation ◽  
Grapevine Cultivar

AbstractChardonnay is the basis of some of the world’s most iconic wines and its success is underpinned by a historic program of clonal selection. There are numerous clones of Chardonnay available that exhibit differences in key viticultural and oenological traits that have arisen from the accumulation of somatic mutations during centuries of asexual propagation. However, the genetic variation that underlies these differences remains largely unknown. To address this knowledge gap, a high-quality, diploid-phased Chardonnay genome assembly was produced from single-molecule real time sequencing, and combined with re-sequencing data from 15 different commercial Chardonnay clones. There were 1620 markers identified that distinguish the 15 Chardonnay clones. These markers were reliably used for clonal identification of validation genomic material, as well as in identifying a potential genetic basis for some clonal phenotypic differences. The predicted parentage of the Chardonnay haplomes was elucidated by mapping sequence data from the predicted parents of Chardonnay (Gouais blanc and Pinot noir) against the Chardonnay reference genome. This enabled the detection of instances of heterosis, with differentially-expanded gene families being inherited from the parents of Chardonnay. Most surprisingly however, the patterns of nucleotide variation present in the Chardonnay genome indicate that Pinot noir and Gouais blanc share an extremely high degree of kinship that has resulted in the Chardonnay genome displaying characteristics that are indicative of inbreeding.Author SummaryPhenotypic variation within a grapevine cultivar arises from an accumulation of mutations from serial vegetative propagation. Old cultivars such as Chardonnay have been propagated for centuries resulting in hundreds of available ‘clones’ containing unique genetic mutations and a range of various phenotypic peculiarities. The genetic mutations can be leveraged as genetic markers and are useful in identifying specific clones for authenticity testing, or as breeding markers for new clonal selections where particular mutations are known to confer a phenotypic trait. We produced a high-quality genome assembly for Chardonnay, and using re-sequencing data for 15 popular clones, were able to identify a large selection of markers that are unique to at least one clone. We identified mutations that may confer phenotypic effects, and were able to identify clones from material independently sourced from nurseries and vineyards. The marker detection framework we describe for authenticity testing would be applicable to other grapevine cultivars or even other agriculturally important woody-plant crops that are vegetatively propagated such as fruit orchards. Finally, we show that the Chardonnay genome contains extensive evidence for parental inbreeding, such that its parents, Gouais blanc and Pinot noir, may even represent first-degree relatives.

scholarly journals Inter-species horizontal toxicity: Experimental control of Argentine ants and their citrophilus mealybug mutualists in a viticultural system

2021 ◽  
Author(s):  
◽  
Catherine Hardiman
Keyword(s):  
Natural Enemies ◽  
Control Method ◽  
Cropping Systems ◽  
Pinot Noir ◽  
Wine Quality ◽  
Argentine Ants ◽  
Invasive Ant ◽  
Food Research ◽  
Leafroll Disease ◽  
Low Toxicity

<p>The invasive Argentine ant, Linepithema humile, is known to form a trophobiotic association with honeydew excreting homopterans Pseudococcus sp. providing protection from natural enemies in exchange for the honeydew they excrete. The vine mealybug Pseudococcus calceolariae, can transmit Grapevine leafroll- associated virus 3 (GLRaV-3) between vines as it travels and feeds with the ensuing leafroll disease negatively impacting on vine health and wine quality. Therefore, if an effective chemical control method targeting incursions of Argentine ants in vineyards contributes to the dissociation of this invasive ant species with its citrophilus mealybug mutualist, then in theory the spread of GLRaV-3 in vineyards by its mealybug vector can be stemmed. Three insecticidal treatments targeting Argentine ants in the canopy of potted Pinot Noir grapevines inoculated with citrophilus mealybugs were trialled at a field site established in Nelson during the summer of 2016/2017. Bifenthrin (1200ppm) was sprayed on vine trunks and the low- toxicity baits, thiamethoxam (0.0006%) or boric acid (0.5%) carried in polyacrylamide gel with 25% sucrose and 0.15% citric acid solution, were placed at the base of vines. A significant decline in ant activity (p < 0.001) and citrophilus mealybugs was observed for the bifenthrin treatment. A follow-on bioassay was conducted at Mt. Albert Plant and Food Research, in the absence of P. calceolariae’s natural enemies to test the hypothesis that the decline in citrophilus mealybugs in response to vines treated with bifenthrin, could in fact be due to inter-species horizontal toxicity because of Argentine ants transferring the toxicant bifenthrin to citrophilus mealybugs while tending them or contaminating the substrate that they fed on. The significant decrease in average citrophilus mealybug activity rate (p < 0.001) for bifenthrin treatments compared with the controls provides evidence for inter-species horizontal toxicity. Bifenthrin sprayed on grapevine trunks may be suitable to control Argentine ants in the vine canopy and indirectly control P. calceolariae, a known vector of GLRaV-3 between grapevine hosts. The concept of inter-species horizontal toxicity could become a model for targeted pest management by exploiting different insect mutualisms in various horticultural cropping systems.</p>

scholarly journals ‘Wongam’, a Licorice Interspecific Hybrid Cultivar with High Yield

2020 ◽  
Vol 52 (4) ◽  
pp. 454-459
Author(s):  
Jeong-Hoon Lee ◽  
Myeong-Won Oh ◽  
Sang-Hoon Lee ◽  
Chun-Geon Park ◽  
Jin-Tae Jeong ◽  
...  
Keyword(s):  
Interspecific Hybrid ◽  
High Yield ◽  
Hybrid Cultivar

scholarly journals Temporal and Spatial Analysis of Grapevine Leafroll-Associated Virus 3 in Pinot Noir Grapevines in Australia

Plant Disease ◽  
1997 ◽  
Vol 81 (6) ◽  
pp. 625-628 ◽  
Author(s):  
Nuredin Habili ◽  
Forrest W. Nutter
Keyword(s):  
New Zealand ◽  
Logistic Model ◽  
Growth Models ◽  
Disease Incidence ◽  
South Australia ◽  
Pinot Noir ◽  
Disease Progress ◽  
Pattern Change ◽  
Leafroll Disease ◽  
Temporal And Spatial

An epidemic of grapevine leafroll disease (GLD), caused by grapevine leafroll-associated virus 3 (GLRaV-3), was monitored over an 11-year period in Nuriootpa, South Australia. Inoculum originated from infected budwood, and initial GLD incidence at the time of transplanting in 1986 was 23.1%. Infected vines were planted in a random spatial pattern. Change in disease incidence was not observed until 8 years after planting, when disease incidence increased to 27.9%. Disease incidence increased to 51.9% by 1996. Disease progress and rate curves (dy/dt versus time) indicated that the logistic (R2 = 96.2) and Gompertz (R2 = 96.3) growth models would best describe disease progress. However, the logistic model, which has a simpler data transformation with fewer model assumptions, was chosen for the purpose of comparing this epidemic (South Australia) with a GLRaV-3 epidemic in Cabernet Sauvignon grapevines in New Zealand. The logistic rate of GLD spread with respect to time was 0.35 logit/year in South Australia and was nearly three times faster (1.19 logits/year) for GLRaV-3 spread in New Zealand. Ordinary runs analyses indicated that the arrangement of infected vines within rows in South Australia was random up to 8 years after transplanting but subsequently became highly aggregated. Thus, GLD-infected plants are contributing to new infections (i.e., there is evidence for plant-to-plant spread), and a biotic vector with a steep dispersal gradient from each point source is likely to be involved.

scholarly journals First Report of Grapevine leafroll-associated virus 1 Infecting Grapevines in India

Plant Disease ◽  
2012 ◽  
Vol 96 (12) ◽  
pp. 1828-1828 ◽  
Author(s):  
S. Kumar ◽  
S. D. Sawant ◽  
I. S. Sawant ◽  
K. Prabha ◽  
R. K. Jain ◽  
...  
Keyword(s):  
Amino Acid ◽  
Acid Level ◽  
Amino Acid Level ◽  
The United States ◽  
Pinot Noir ◽  
Rt Pcr ◽  
Nucleotide Level ◽  
First Report ◽  
Leafroll Disease ◽  
Das Elisa

Viticulture, one of the most remunerative farming enterprises of India, is seriously affected by leafroll disease, which accounts for 62% of the losses in grape production worldwide due to viral diseases (4). Grapevine leafroll-associated virus 3 and 1 (GLRaV-3 and GLRaV-1) of the family Closteroviridae are the two most common viruses associated with the leafroll disease of grapevine (1). GLRaV-3 was previously confirmed in India through RT-PCR, cloning, and sequencing (2). A survey was conducted during 2010 and 2011 in the Nashik and Pune regions of western India and reddening of interveinal areas and downward rolling, typical symptoms of leafroll disease in dark fruited cultivars, were observed, first in 2010 and subsequently in 2011. Fourteen leafroll symptomatic samples from seven cultivars of seven vineyards were collected during 2011. Samples were subjected to double antibody sandwich (DAS)-ELISA using commercially available antibodies against GLRaV-3 and GLRaV-1 (Bioreba, Reinach, Switzerland) (2). An asymptomatic sample from another cultivar of a different vineyard and samples from two plantlets of two different cultivars produced in tissue culture were used as negative controls. GLRaV-1 was detected in two cultivars, Shiraj (Nashik region) and Pinot Noir (Pune region) using DAS-ELISA. GLRaV-1 was detected either alone in cultivar Pinot Noir or as mixed infection with GLRaV-3 in cultivar Shiraj. To further confirm the presence of GLRaV-1 in these two cultivars, crude extract from petioles of these two cultivars were subjected to one step reverse transcription (RT)-PCR using GLRaV-1 specific primers pORF9F and pORF9R (GGCTCGAGATGGCGTCACTTATACCTA and CCTCTAGACACCAAATTGCTAGCGA, respectively) (3). The ˜650 bp amplicons were cloned in pGEM-T easy vector and three independent clones of each amplicon were sequenced in both directions. The cloned amplified product was 646 bp, including 630 bp of p24 protein (ORF9) of GLRaV-1. Comparative sequence analysis, using the BioEdit 7.0.3 program ( http://www.mbio.ncsu.edu/BioEdit/BioEdit.html ), of ORF9 of the virus under study from the cultivars Pinot Noir and Shiraj shared maximum sequence identity of 95.8 and 96.1%, respectively, at the nucleotide level with the Clatervine isolate from the United States (GenBank Accession No. HQ833477). The corresponding values of maximum identities at the amino acid level were 96.6 and 96.1%, respectively, with the same Clatervine isolate. The maximum identity between these two isolates of GLRaV-1 was 96.1% at nucleotide level and 95.7% at amino acid level. To the best of our knowledge, this study represents the first report of GLRaV-1 from India. Grape production in India could be impacted by this virus; thus, identification of the virus is important. References: (1) B. Akbas et al. Hort. Sc. (Prague). 36: 97, 2009. (2) S. Kumar et al. Virus Genes. 45:195, 2012. (3) A. Little and M. A. Rezaian. Arch. Virol. 151:753, 2006. (4) A. Little et al. Virus Res. 80:109, 2001.

Sign in / Sign up

Export Citation Format

Share Document