scholarly journals Combined Effects of UV-B and Drought on Native and Exotic Populations of Verbascum thapsus L.

Plants ◽  
2020 ◽  
Vol 9 (2) ◽  
pp. 269 ◽  
Author(s):  
Maria Hock ◽  
Carolin Plos ◽  
Maria Sporbert ◽  
Alexandra Erfmeier
Keyword(s):  
New Zealand ◽  
Stress Responses ◽  
Abiotic Factors ◽  
Morphological Characteristics ◽  
Plant Invasions ◽  
Ultraviolet B ◽  
Stress Factors ◽  
Adaptive Responses ◽  
Resistant Plant ◽  
Verbascum Thapsus

During plant invasions, exotic species have to face new environmental challenges and are affected by interacting components of global change, which may include more stressful environmental conditions. We investigated an invasive species of New Zealand grasslands, commonly exposed to two concomitant and limiting abiotic factors—high levels of ultraviolet-B radiation and drought. The extent to which Verbascum thapsus may respond to these interacting stress factors via adaptive responses was assessed in a greenhouse experiment comprising native German plants and plants of exotic New Zealand origins. Plants from both origins were grown within four treatments resulting from the crossed combinations of two levels of UV-B and drought. Over twelve weeks, we recorded growth, morphological characteristics, physiological responses and productivity. The results showed that drought stress had the strongest effect on biomass, morphology and physiology. Significant effects of UV-B radiation were restricted to variables of leaf morphology and physiology. We found neither evidence for additive effects of UV-B and drought nor origin-dependent stress responses that would indicate local adaptation of native or exotic populations. We conclude that drought-resistant plant species might be predisposed to handle high UV-B levels, but emphasize the importance of setting comparable magnitudes in stress levels when testing experimentally for antagonistic interaction effects between two manipulated factors.

scholarly journals Mechanisms Regulating the Dynamics of Photosynthesis Under Abiotic Stresses

2021 ◽  
Vol 11 ◽  
Author(s):  
Izhar Muhammad ◽  
Abdullah Shalmani ◽  
Muhammad Ali ◽  
Qing-Hua Yang ◽  
Husain Ahmad ◽  
...  
Keyword(s):  
Stress Responses ◽  
Abiotic Stresses ◽  
Regulatory Networks ◽  
Abiotic Factors ◽  
Regulatory Elements ◽  
Stress Factors ◽  
Yield Potential ◽  
Plant Responses ◽  
Data Set ◽  
Photosynthetic Machinery

Photosynthesis sustains plant life on earth and is indispensable for plant growth and development. Factors such as unfavorable environmental conditions, stress regulatory networks, and plant biochemical processes limits the photosynthetic efficiency of plants and thereby threaten food security worldwide. Although numerous physiological approaches have been used to assess the performance of key photosynthetic components and their stress responses, though, these approaches are not extensive enough and do not favor strategic improvement of photosynthesis under abiotic stresses. The decline in photosynthetic capacity of plants due to these stresses is directly associated with reduction in yield. Therefore, a detailed information of the plant responses and better understanding of the photosynthetic machinery could help in developing new crop plants with higher yield even under stressed environments. Interestingly, cracking of signaling and metabolic pathways, identification of some key regulatory elements, characterization of potential genes, and phytohormone responses to abiotic factors have advanced our knowledge related to photosynthesis. However, our understanding of dynamic modulation of photosynthesis under dramatically fluctuating natural environments remains limited. Here, we provide a detailed overview of the research conducted on photosynthesis to date, and highlight the abiotic stress factors (heat, salinity, drought, high light, and heavy metal) that limit the performance of the photosynthetic machinery. Further, we reviewed the role of transcription factor genes and various enzymes involved in the process of photosynthesis under abiotic stresses. Finally, we discussed the recent progress in the field of biodegradable compounds, such as chitosan and humic acid, and the effect of melatonin (bio-stimulant) on photosynthetic activity. Based on our gathered researched data set, the logical concept of photosynthetic regulation under abiotic stresses along with improvement strategies will expand and surely accelerate the development of stress tolerance mechanisms, wider adaptability, higher survival rate, and yield potential of plant species.

White clover sensitivity to UV-B radiation - biochemical relationships and interaction with drought

2003 ◽  
pp. 273-277
Author(s):  
R.W. Hofmann ◽  
B.D. Campbell ◽  
E.E. Swinny ◽  
S.J. Bloor ◽  
K.R. Markham ◽  
...  
Keyword(s):  
New Zealand ◽  
White Clover ◽  
Ultraviolet B ◽  
Summer Drought ◽  
Stress Protection ◽  
Trade Offs ◽  
Population Comparisons ◽  
Potential Benefits ◽  
Quercetin Glycosides ◽  
Balance Trade

During summertime in New Zealand, white clover experiences high levels of ultraviolet-B (UV-B) radiation. This frequently coincides with periods of summer drought. We investigated responses to UV-B and to the combination of UV-B and drought in various white clover populations, including New Zealand cultivars and ecotypes as well as overseas germplasm. The results were obtained under controlled environmental conditions in three independent trials. Overall, white clover growth was reduced by UV-B. The population comparisons indicated that low growth rate and adaptation to other forms of stress may be related to UV-B tolerance under well-watered conditions, but not during extended periods of drought. Flavonoid pigments that are involved in stress protection were strongly increased under UV-B and were further enhanced in the combination of UV-B and drought. The responses among these flavonoids were highly specific, with more pronounced UV-B-induced increases in quercetin glycosides, compared to their closely related kaempferol counterparts. UV-B toler ance of the less productive white clover populations was linked to the accumulation of quercetin compounds. In conclusion, these studies suggest (i) that slow-growing white clover ecotypes adapted to other stresses have higher capacity for biochemical acclimation to UV-B under well-watered conditions and (ii) that these biochemical attributes may also contribute to decreased UV-B sensitivity across white clover populations under drought. The findings alert plant breeders to potential benefits of selecting productive germplasm for high levels of specific flavonoids to balance trade-offs between plant productivity and stress tolerance. Keywords: Drought, flavonoids, genetic variation, HPLC, kaempferol, quercetin, str ess, Trifolium repens L., ultraviolet-B, white clover

scholarly journals Increasing Solvent Tolerance to Improve Microbial Production of Alcohols, Terpenoids and Aromatics

2021 ◽  
Vol 9 (2) ◽  
pp. 249
Author(s):  
Thomas Schalck ◽  
Bram Van den Bergh ◽  
Jan Michiels
Keyword(s):  
Stress Responses ◽  
Small Rnas ◽  
Defense Mechanisms ◽  
Industrial Processes ◽  
Solvent Tolerance ◽  
Adaptive Responses ◽  
Environment Friendly ◽  
Pathway Optimization ◽  
Polymer Precursors ◽  
Product Accumulation

Fuels and polymer precursors are widely used in daily life and in many industrial processes. Although these compounds are mainly derived from petrol, bacteria and yeast can produce them in an environment-friendly way. However, these molecules exhibit toxic solvent properties and reduce cell viability of the microbial producer which inevitably impedes high product titers. Hence, studying how product accumulation affects microbes and understanding how microbial adaptive responses counteract these harmful defects helps to maximize yields. Here, we specifically focus on the mode of toxicity of industry-relevant alcohols, terpenoids and aromatics and the associated stress-response mechanisms, encountered in several relevant bacterial and yeast producers. In practice, integrating heterologous defense mechanisms, overexpressing native stress responses or triggering multiple protection pathways by modifying the transcription machinery or small RNAs (sRNAs) are suitable strategies to improve solvent tolerance. Therefore, tolerance engineering, in combination with metabolic pathway optimization, shows high potential in developing superior microbial producers.

scholarly journals Jute Responses and Tolerance to Abiotic Stress: Mechanisms and Approaches

Plants ◽  
2021 ◽  
Vol 10 (8) ◽  
pp. 1595
Author(s):  
Khussboo Rahman ◽  
Naznin Ahmed ◽  
Md. Rakib Hossain Raihan ◽  
Farzana Nowroz ◽  
Faria Jannat ◽  
...  
Keyword(s):  
Abiotic Stress ◽  
Stress Responses ◽  
Growth Yield ◽  
Climatic Conditions ◽  
Stress Factors ◽  
Growth Physiology ◽  
Abiotic Stress Factors ◽  
Hot And Humid Climates ◽  
Adverse Environmental Conditions ◽  
Cold Metal

Jute (Corchorus spp.) belongs to the Malvaceae family, and there are two species of jute, C. capsularis and C. olitorious. It is the second-largest natural bast fiber in the world according to production, which has diverse uses not only as a fiber but also as multiple industrial materials. Because of climate change, plants experience various stressors such as salt, drought, heat, cold, metal/metalloid toxicity, and flooding. Although jute is particularly adapted to grow in hot and humid climates, it is grown under a wide variety of climatic conditions and is relatively tolerant to some environmental adversities. However, abiotic stress often restricts its growth, yield, and quality significantly. Abiotic stress negatively affects the metabolic activities, growth, physiology, and fiber yield of jute. One of the major consequences of abiotic stress on the jute plant is the generation of reactive oxygen species, which lead to oxidative stress that damages its cellular organelles and biomolecules. However, jute’s responses to abiotic stress mainly depend on the plant’s age and type and duration of stress. Therefore, understanding the abiotic stress responses and the tolerance mechanism would help plant biologists and agronomists in developing climate-smart jute varieties and suitable cultivation packages for adverse environmental conditions. In this review, we summarized the best possible recent literature on the plant abiotic stress factors and their influence on jute plants. We described the possible approaches for stress tolerance mechanisms based on the available literature.

scholarly journals Development of an Improved Carotenoid Extraction Method to Characterize the Carotenoid Composition under Oxidative Stress and Cold Temperature in the Rock Inhabiting Fungus Knufia petricola A95

2018 ◽  
Vol 4 (4) ◽  
pp. 124 ◽  
Author(s):  
Kerstin Flieger ◽  
Nicole Knabe ◽  
Jörg Toepel
Keyword(s):  
Oxidative Stress ◽  
Stress Responses ◽  
Stress Factors ◽  
Black Yeast ◽  
Black Yeasts ◽  
Protective Agent ◽  
Extraction And Separation ◽  
Carotenoid Composition ◽  
Other Substances ◽  
Promising Source

Black yeasts are a highly specified group of fungi, which are characterized by a high resistance against stress factors. There are several factors enabling the cells to survive harsh environmental conditions. One aspect is the pigmentation, the melanin black yeasts often display a highly diverse carotenoid spectrum. Determination and characterization of carotenoids depend on an efficient extraction and separation, especially for black yeast, which is characterized by thick cell walls. Therefore, specific protocols are needed to ensure reliable analyses regarding stress responses in these fungi. Here we present both. First, we present a method to extract and analyze carotenoids and secondly we present the unusual carotenoid composition of the black yeast Knufia petricola A95. Mechanical treatment combined with an acetonitrile extraction gave us very good extraction rates with a high reproducibility. The presented extraction and elution protocol separates the main carotenoids (7) in K. petricola A95 and can be extended for the detection of additional carotenoids in other species. K. petricola A95 displays an unusual carotenoid composition, with mainly didehydrolycopene, torulene, and lycopene. The pigment composition varied in dependency to oxidative stress but remained relatively constant if the cells were cultivated under low temperature. Future experiments have to be carried out to determine if didehydrolycopene functions as a protective agent itself or if it serves as a precursor for antioxidative pigments like torulene and torularhodin, which could be produced after induction under stress conditions. Black yeasts are a promising source for carotenoid production and other substances. To unravel the potential of these fungi, new methods and studies are needed. The established protocol allows the determination of carotenoid composition in black yeasts.

scholarly journals Effect of abiotic factors on sulfidogenic activity of bacteria Desulfuromonas sp.

2020 ◽  
Vol 11 (2) ◽  
pp. 170-174
Author(s):  
O. M. Сhaіka ◽  
T. B. Peretyatko
Keyword(s):  
Hydrogen Sulfide ◽  
Cell Density ◽  
Elemental Sulfur ◽  
Abiotic Factors ◽  
Electron Acceptors ◽  
Stress Factors ◽  
Sulfide Concentration ◽  
Sulfur Concentration ◽  
Reducing Bacteria ◽  
Hydrogen Sulfide Concentration

Sulfur-reducing bacteria are promising agents for the development of new methods of wastewater treatment with the removal of ions of heavy metals and organic compounds. Study of the effect of various environmental factors on the growth and sulfidogenic activity of sulfur-reducing bacteria allows one to investigate the adaptability of these microorganisms to stress factors. The paper deals with the effect of рН, different concentrations of elemental sulfur, hydrogen sulfide and presence of various electron acceptors on the growth and sulfidogenic activity of bacteria Desulfuromonas sp. YSDS-3. The calculation of C/S ratio for sulfur-reducing bacteria Desulfuromonas sp. YSDS-3 was made, with the comparison with similar parameters of sulfate-reducing bacteria. In the medium with elemental sulfur, concentration of hydrogen sulfide increased with the concentration of elemental sulfur. Bacteria Desulfuromonas sp. YSDS-3 accumulated their biomass in the most effective way at the concentration of elemental sulfur of 10–100 mM. In the medium with polysulfide form of sulfur at the neutral pH, bacteria produced hydrogen sulfide and accumulated biomass the best. Hydrogen sulfide at the concentration of 3 mM did not inhibit the bacterial growth, but further increase in the hydrogen sulfide concentration inhibited the growth of bacteria. The bacteria did not grow at the hydrogen sulfide concentration of 25 mM and above. As the concentration of elemental sulfur and cell density increases, sulfidogenic activity of the bacteria grows. Presence of two electron acceptors (S and K2Cr2O7, S and MnO2, S and Fe (III)) did not affect the accumulation of biomass of the bacteria Desulfuromonas sp. YSDS-3. However, under such conditions the bacteria accumulated 1.5–2.5 times less hydrogen sulfide than in the test medium. After 12–24 h of cultivation, different concentrations of elemental sulfur had a significant effect on the sulfidogenic activity. However, during 3–16 days of cultivation, the percentage of effect of elemental sulfur concentration decreased to 31%, while the percentage of effect of cell density increased threefold. Presence in the medium of the electron acceptors (Cr (VI), MnO2, Fe (III)) alternative to elemental sulfur led to a significant decrease in the content of hydrogen sulfide produced by sulfur-reducing bacteria.

scholarly journals First Report of Alternaria carotiincultae on Carrot Seed Produced in New Zealand

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1168-1168
Author(s):  
R. S. Trivedi ◽  
J. G. Hampton ◽  
J. M. Townshend ◽  
M. V. Jaspers ◽  
H. J. Ridgway
Keyword(s):  
New Zealand ◽  
Morphological Characteristics ◽  
New Taxon ◽  
First Report ◽  
Agar Plug ◽  
Carrot Seed ◽  
Agar Media ◽  
Leaves And Roots ◽  
Seed Crops ◽  
Β Tubulin

Carrot (Daucus carota L.) seed lots produced in Canterbury, New Zealand are commonly infected by the fungal pathogen Alternaria radicina, which can cause abnormal seedlings and decayed seeds. In 2008, samples of 400 seeds from each of three carrot seed crops were tested for germination on moistened paper towels. On average, 30% of the seeds developed into abnormal seedlings or were decayed and were plated onto A. radicina selective agar (2) and acidified potato dextrose agar media and grown for 15 days at 22°C (10 h/14 h light/dark cycle) to confirm the presence of this pathogen (3). However, another fungus was isolated from an average of 8% of the seeds sampled. Colonies of the latter fungus grew faster than those of A. radicina, had smoother margins, and did not produce dendritic crystals or yellow pigment in the agar media. Although conidial size (30 to 59 × 18 to 20 μm), shape (long and ellipsoid), and color (dark olive-brown) were similar for the two fungi, conidia of this novel fungus had more transverse septa (average 3.6 cf. 3.0 per conidium) than those of A. radicina. On the basis of these morphological characteristics, the isolated fungus was identified as A. carotiincultae and the identity was confirmed by sequence analysis. PCR amplification of the β-tubulin gene from three isolates, using primers Bt1a (5′ TTCCCCCGTCTCCACTTCTTCATG 3′) and Bt1b (5′ GACGAGATCGTTCATGTTGAACTC 3′) (1), produced a 420-bp product for each isolate that was sequenced and compared with β-tubulin sequences present in GenBank. Sequences of all three New Zealand isolates (Accession Nos. HM208752, HM208753, and HM208754) were identical to each other and to six sequences in GenBank (Accession Nos. EU139354/57/58/59/61/62). There was a 2- to 4-bp difference between these sequences and those of A. radicina present in GenBank. Pathogenicity of the three New Zealand isolates of A. carotiincultae was verified on leaves and roots of 3-month-old carrot plants grown in a greenhouse (three plants per pot with 10 replicate pots per isolate). For each isolate, intact leaves of each plant were inoculated with 0.5 ml of a suspension of 106 conidia/ml and the tap root of each plant was inoculated with a 7-mm agar plug colonized by the isolate. Ten pots of control plants were treated similarly with sterile water and noncolonized agar plugs. Each pot was covered with a plastic bag for 12 h and then placed in a mist chamber in a greenhouse with automatic misting every 30 min. At 72 h after inoculation, symptoms comprising medium brown-to-black lesions on the leaves and dark brown-to-black sunken lesions on the roots were clearly visible on inoculated plants but not on the control plants. Reisolation attempts from roots and leaves demonstrated A. carotiincultae to be present in symptomatic leaves and roots of all inoculated plants but not in leaves or roots of the control plants. Symptoms produced by the isolates of A. carotiincultae were similar to those attributed to A. radicina in infected carrot seed fields in Canterbury. The former species may have caused field infections in carrot seed crops in Canterbury. A. carotiincultae was described as a new taxon in Ohio in 1995 (4), and pathogenicity of the species on carrot was reported in California (3). To our knowledge, this is the first report of A. carotiincultae in New Zealand. References: (1) M. S. Park et al. Mycologia 100:511, 2008. (2) B. M. Pryor et al. Plant Dis. 78:452, 1994. (3) B. M. Pryor and R. L. Gilbertson. Mycologia 94:49, 2002. (4) E. G. Simmons. Mycotaxon 55:55, 1995.

scholarly journals Research Advances on Tall Fescue Salt Tolerance: From Root Signaling to Molecular and Metabolic Adjustment

2017 ◽  
Vol 142 (5) ◽  
pp. 337-345 ◽  
Author(s):  
Erick Amombo ◽  
Huiying Li ◽  
Jinmin Fu
Keyword(s):  
Salinity Stress ◽  
Tall Fescue ◽  
Festuca Arundinacea ◽  
Crop Productivity ◽  
Stress Factors ◽  
Adaptive Responses ◽  
Salt Tolerant ◽  
Cool Season ◽  
Abiotic Stress Factors ◽  
Metabolic Adjustment

Soil salinity is one of the major abiotic stress factors that constrain plant growth and limit crop productivity. About a quarter of the global land area is affected by salinity; therefore, there is increased need to develop salt-tolerant crops. Tall fescue (Festuca arundinacea) is one of the most important cool-season turfgrasses, which has medium tolerance to salinity and has a promising potential to be used as a turfgrass under saline conditions. However, up to now, the maximum use of tall fescue under salinity stress is still limited by inadequate scientific literature. Recent studies have attempted to identify various adaptive responses to salinity stress at molecular, cellular, metabolic, and physiological levels in tall fescue. The successful integration of information concerning signal sensing, molecular tools with recent advances in -omics would certainly provide a clue for creating salt-tolerant tall fescue. Because salinity limits water availability to plants via hindering water absorption, and by inducing physiological drought, here we review and propose a probable mechanism of tall fescue response to salinity stress and to similar effects induced by drought based on published literature.

scholarly journals A Mass Spectrometry-Based Study Shows that Volatiles Emitted by Arthrobacter agilis UMCV2 Increase the Content of Brassinosteroids in Medicago truncatula in Response to Iron Deficiency Stress

Molecules ◽  
2019 ◽  
Vol 24 (16) ◽  
pp. 3011
Author(s):  
Idolina Flores-Cortez ◽  
Robert Winkler ◽  
Arturo Ramírez-Ordorica ◽  
Ma. Isabel Cristina Elizarraraz-Anaya ◽  
María Teresa Carrillo-Rayas ◽  
...  
Keyword(s):  
Mass Spectrometry ◽  
Iron Deficiency ◽  
Medicago Truncatula ◽  
Stress Responses ◽  
Crop Yields ◽  
Abiotic Factors ◽  
Defense Responses ◽  
Iron Deficient ◽  
Arthrobacter Agilis ◽  
Microbial Volatiles

Iron is an essential plant micronutrient. It is a component of numerous proteins and participates in cell redox reactions; iron deficiency results in a reduction in nutritional quality and crop yields. Volatiles from the rhizobacterium Arthrobacter agilis UMCV2 induce iron acquisition mechanisms in plants. However, it is not known whether microbial volatiles modulate other metabolic plant stress responses to reduce the negative effect of iron deficiency. Mass spectrometry has great potential to analyze metabolite alterations in plants exposed to biotic and abiotic factors. Direct liquid introduction-electrospray-mass spectrometry was used to study the metabolite profile in Medicago truncatula due to iron deficiency, and in response to microbial volatiles. The putatively identified compounds belonged to different classes, including pigments, terpenes, flavonoids, and brassinosteroids, which have been associated with defense responses against abiotic stress. Notably, the levels of these compounds increased in the presence of the rhizobacterium. In particular, the analysis of brassinolide by gas chromatography in tandem with mass spectrometry showed that the phytohormone increased ten times in plants grown under iron-deficient growth conditions and exposed to microbial volatiles. In this mass spectrometry-based study, we provide new evidence on the role of A. agilis UMCV2 in the modulation of certain compounds involved in stress tolerance in M. truncatula.

Sign in / Sign up

Export Citation Format

Share Document