scholarly journals Chloroplast Genome Draft of Dryobalanops aromatica Generated Using Oxford Nanopore Technology and Its Potential Application for Phylogenetic Study

Forests ◽  
2021 ◽  
Vol 12 (11) ◽  
pp. 1515
Author(s):  
Dwi Wahyuni ◽  
Fifi Gus Dwiyanti ◽  
Rahadian Pratama ◽  
Muhammad Majiidu ◽  
Henti Hendalastuti Rachmat ◽  
...  
Keyword(s):  
Dna Sequencing ◽  
Phylogenetic Tree ◽  
Chloroplast Genome ◽  
Dna Sequences ◽  
Genetic Relationships ◽  
Phylogenetic Study ◽  
Phylogenomic Analysis ◽  
Rbcl Gene ◽  
Oxford Nanopore ◽  
Long Read

Kapur (Dryobalanops aromatica) is an important dipterocarp species currently classified as vulnerable by the IUCN Red List Threatened Species. Science-based conservation and restoration efforts are needed, which can be supported by new genomic data generated from new technologies, including MinION Oxford Nanopore Technology (ONT). ONT allows affordable long-read DNA sequencing, but this technology is still rarely applied to native Indonesian forest trees. Therefore, this study aimed to generate whole genome datasets through ONT and use part of these data to construct the draft of the chloroplast genome and analyze the universal DNA barcode-based genetic relationships for D. aromatica. The method included DNA isolation, library preparation, sequencing, bioinformatics analysis, and phylogenetic tree construction. Results showed that the DNA sequencing of D. aromatica resulted in 1.55 Gb of long-read DNA sequences from which a partial chloroplast genome (148,856 bp) was successfully constructed. The genetic relationship was analyzed using two selected DNA barcodes (rbcL and matK), and its combination showed that species of the genus Dryobalanops had a close relationship as indicated by adjacent branches between species. The phylogenetic tree of matK and the combination of the matK and rbcL genes showed that D. aromatica was closely related to Dryobalanops rappa, whereas the rbcL gene showed group separation between D. aromatica and D. rappa. Therefore, a combination of the matK and rbcL genes is recommended for future use in the phylogenetic or phylogenomic analysis of D. aromatica.

scholarly journals Phylogenetic study of mangrove associate grass Myriostachya wightiana (Nees ex Steud.) Hook. f. using rbcL gene sequence

2021 ◽  
Vol 8 (3) ◽  
Author(s):  
K M Kiran ◽  
B V Sandeep
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Tree ◽  
Gene Sequence ◽  
Phylogenetic Study ◽  
Rbcl Gene ◽  
Evolutionary Divergence ◽  
Multiple Sequence ◽  
Sorghum Propinquum ◽  
Oryza Punctata ◽  
Mangrove Associate

Myriostachya is a monotypic genus in the family Poaceae, with the only known species Myriostachya wightiana (Nees ex Steud.) Hook.f. It is a mangrove associate grass primarily distributed along the muddy streams and channels in intertidal mangrove swamps of India, Bangladesh, Sri Lanka, Myanmar, Thailand and Sumatra. Molecular identification and evolutionary studies of M. wightiana is unreported till now. Therefore, in this study, the phylogenetic analysis of M. wightiana was established with related family members by using chloroplast rbcL gene-based systematics. The molecular phylogeny was accomplished by DNA extraction, PCR amplification and sequencing of the rbcL gene and phylogenetic analysis. The genomic DNA was extract using the CTAB method and the rbcL gene amplification is by using the F-5IATGTCACCACAAACAGAAACTAAAGC3I and R-5ICTTCGGCACAAAATAAGAAACGATCTC3I primers. Phylogenetic analysis of M. wightiana was performed by multiple sequence alignment with UPGMA, and the Maximum-parsimony phylogenetic tree was constructed using MEGAX. Myriostachya wightiana rbcL gene sequence shows the highest similarity to Paspalum species, and in the phylogenetic tree M. wightiana has a close branch with Paspalum vaginatum. The evolutionary divergence from M. wightiana is maximum (0.49) to Sorghum propinquum and minimum (0.01) to Oryza officinalis and Oryza punctata. This study concluded that M. wightiana has a strong morphological and phylogenetic relationship with salt-tolerant Paspalum sp.

scholarly journals BleTIES: Annotation of natural genome editing in ciliates using long read sequencing

2021 ◽  
Author(s):  
Brandon K. B. Seah ◽  
Estienne C. Swart
Keyword(s):  
Dna Sequences ◽  
Sequence Data ◽  
Low Complexity ◽  
Supplementary Information ◽  
Neighboring Element ◽  
Sequencing Technologies ◽  
Long Reads ◽  
Oxford Nanopore ◽  
Long Read ◽  
Element Elimination

Ciliates are single-celled eukaryotes that eliminate specific, interspersed DNA sequences (internally eliminated sequences, IESs) from their genomes during development. These are challenging to annotate and assemble because IES-containing sequences are much less abundant in the cell than those without, and IES sequences themselves often contain repetitive and low-complexity sequences. Long read sequencing technologies from Pacific Biosciences and Oxford Nanopore have the potential to reconstruct longer IESs than has been possible with short reads, and also the ability to detect correlations of neighboring element elimination. Here we present BleTIES, a software toolkit for detecting, assembling, and analyzing IESs using mapped long reads. Availability and implementation: BleTIES is implemented in Python 3. Source code is available at https://github.com/Swart-lab/bleties (MIT license), and also distributed via Bioconda. Contact: [email protected] Supplementary information: Benchmarking of BleTIES with published sequence data.

scholarly journals Robust long-read native DNA sequencing using the ONT CsgG Nanopore system

2017 ◽  
Vol 2 ◽  
pp. 23 ◽  
Author(s):  
Jean-Michel Carter ◽  
Shobbir Hussain
Keyword(s):  
Dna Sequencing ◽  
Cancer Cell Line ◽  
Read Length ◽  
Nanopore Sequencing ◽  
Computational Tools ◽  
Practical Applications ◽  
Oxford Nanopore ◽  
Sequencing Method ◽  
Long Read ◽  
Oxford Nanopore Technologies

Background: The ability to obtain long read lengths during DNA sequencing has several potentially important practical applications. Especially long read lengths have been reported using the Nanopore sequencing method, currently commercially available from Oxford Nanopore Technologies (ONT). However, early reports have demonstrated only limited levels of combined throughput and sequence accuracy. Recently, ONT released a new CsgG pore sequencing system as well as a 250b/s translocation chemistry with potential for improvements. Methods: We made use of such components on ONTs miniature ‘MinION’ device and sequenced native genomic DNA obtained from the near haploid cancer cell line HAP1. Analysis of our data was performed utilising recently described computational tools tailored for nanopore/long-read sequencing outputs, and here we present our key findings. Results: From a single sequencing run, we obtained ~240,000 high-quality mapped reads, comprising a total of ~2.3 billion bases. A mean read length of 9.6kb and an N50 of ~17kb was achieved, while sequences mapped to reference with a mean identity of 85%. Notably, we obtained ~68X coverage of the mitochondrial genome and were able to achieve a mean consensus identity of 99.8% for sequenced mtDNA reads. Conclusions: With improved sequencing chemistries already released and higher-throughput instruments in the pipeline, this early study suggests that ONT CsgG-based sequencing may be a useful option for potential practical long-read applications.

Processing human frontal cortex brain tissue for population-scale Oxford Nanopore long-read DNA sequencing SOP v1

2021 ◽  
Author(s):  
Kimberley J J Billingsley ◽  
Ramita Dewan ◽  
Laksh Malik ◽  
Pilar Alvarez Jerez ◽  
Stith Kiley ◽  
...  
Keyword(s):  
Alzheimer’S Disease ◽  
Alzheimer's Disease ◽  
Dna Sequencing ◽  
Frontal Cortex ◽  
Brain Tissue ◽  
Sequencing Data ◽  
Oxford Nanopore ◽  
Human Frontal Cortex ◽  
Long Read ◽  
Population Scale

Processing human frontal cortex brain tissue for population-scale Oxford Nanopore long-read DNA sequencing SOP At the NIH's Center for Alzheimer's and Related Dementias (CARD) https://card.nih.gov/research-programs/long-read-sequencing we will generate long-read sequencing data from roughly 4000 patients with Alzheimer's disease, frontotemporal dementia, Lewy body dementia, and healthy subjects. With this research, we will build a public resource consisting of long-read genome sequencing data from a large number of confirmed people with Alzheimer's disease and related dementias and healthy individuals. To generate this large-scale nanopore sequencing data we have developed a protocol for processing and long-read sequencing human frontal cortex brain tissue, targeting an N50 of ~30kb and ~30X coverage. †Correspondence to: Kimberley Billingsley [email protected] and Cornelis Blauwendraat [email protected] Acknowledgements: We would like to thank the Nanopore team (Androo Markham &Hannah Lucio), Circulomics Inc team (Jeffrey Burke, Michelle Kim, Duncan Kilburn & Kelvin Liu) and the whole CARD long-read team listed below => UCSC: Benedict Paten, Mikhail Kolmogorov, Miten Jain, Kishwar Shafin, Trevor Pesout; NHGRI: Adam Phillippy, Arang Rhie; Baylor: Fritz Sedlazeck; JHU: Winston Timp; NINDS: Sonja Scholz; NIA: Cornelis Blauwendraat, Kimberley Billingsley, Frank Grenn, Pilar Alvarez Jerez, Bryan Traynor, Shannon Ballard, Caroline Pantazis; CZI: Paolo Carnevali.

Molecular approaches to the study of plant biosystematics

1990 ◽  
Vol 3 (1) ◽  
pp. 1 ◽  
Author(s):  
MT Clegg ◽  
ML Durbin
Keyword(s):  
Dna Sequencing ◽  
Chloroplast Genome ◽  
Molecular Cloning ◽  
Dna Sequence ◽  
Restriction Site ◽  
Genetic Relationships ◽  
Plant Evolution ◽  
The Family ◽  
Family Level ◽  
Pcr Method

Genetic relationships among organisms can be estimated from the pattern of DNA sequence change between hereditary molecules. The methods of molecular biology are increasingly being employed in systematic and evolutionary research to study genetic relationships and phylogeny. The investigator is faced with a variety of choices in initiating research in 'molecular biosystematics'. First, a gene or genome that provides a level of genetic resolution appropriate for the materials under study must be selected. Common choices in plants include the chloroplast genome (cpDNA) or components of the chloroplast genome, the nuclear ribosomal RNA genes (rDNA), or nuclear-encoded, single-copy genes. A second consideration is that several methods can be employed to provide direct or indirect measures of DNA sequence divergence. One widely used method determines genetic divergence based on restriction site changes. Restriction site analyses typically require some knowledge of the physical map of the DNA molecule under study. Empirical studies indicate that restriction site analyses of cpDNA provide good resolution for systematic investigations at or below the family level. A second method that is increasing in importance is DNA sequencing. Until quite recently, DNA sequencing required the molecular cloning of the gene or DNA fragment of interest and the implementation of a 'sequencing strategy' for the production of overlapping sequence runs. Two related technological developments have overcome both of these requirements, when the goal is the repetitive sequencing of a specific gene from a number of taxa. It is now possible to synthesise synthetic oligonucleotides that can be used to prime dideoxy sequencing at virtually any point in the gene of interest, based on previously determined sequence information. The second major innovation is the invention of the polymerase chain reaction technique (PCR). The PCR method permits the direct amplification of DNA fragments from heterogeneous DNA mixtures and thereby circumvents the molecular cloning requirement. Application of the PCR method to chloroplast genes, together with direct primer-mediated sequencing, provides a method for obtaining large data sets. CpDNA sequence data are especially valuable at or above the family level and provide a powerful means of resolving genetic relationships at the deepest levels of plant evolution.

scholarly journals Generating long-read sequences using Oxford Nanopore Technology from Diospyros celebica genomic DNA

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Iskandar Zulkarnaen Siregar ◽  
Fifi Gus Dwiyanti ◽  
Rahadian Pratama ◽  
Deden Derajat Matra ◽  
Muhammad Majiidu
Keyword(s):  
Dna Sequences ◽  
Plant Genetic Resources ◽  
Sustainable Use ◽  
Genomic Analysis ◽  
Genomic Research ◽  
Sequencing Technology ◽  
Data Description ◽  
Oxford Nanopore ◽  
Long Read ◽  
The Tropics

Abstract Objectives Development of sequencing technology has opened up vast opportunities for tree genomic research in the tropics. One of the aforesaid technologies named ONT (Oxford Nanopore Technology) has attracted researchers in undertaking testings and experiments due to its affordability and accessibility. To the best of our knowledge, there has been no published reports on the use of ONT for genomic analysis of Indonesian tree species. This progress is promising for further improvement in order to acquire more genomic data for research purposes. Therefore, the present study was carried out to determine the effectiveness of ONT in generating long-read DNA sequences using DNA isolated from leaves and wood cores of Macassar ebony (Diospyros celebica Bakh.). Data description Long-read sequences data of leaves and wood cores of Macassar ebony were generated by using the MinION device and MinKnow v3.6.5 (ONT). The obtained data, as the first long-read sequence dataset for Macassar ebony, is of great importance to conserve the genetic diversity, understanding the molecular mechanism, and sustainable use of plant genetic resources for downstream applications.

scholarly journals Gene Loss and Evolution of the Plastome

Genes ◽  
2020 ◽  
Vol 11 (10) ◽  
pp. 1133
Author(s):  
Tapan Kumar Mohanta ◽  
Awdhesh Kumar Mishra ◽  
Adil Khan ◽  
Abeer Hashem ◽  
Elsayed Fathi Abd_Allah ◽  
...  
Keyword(s):  
Chloroplast Genome ◽  
Dna Sequences ◽  
Nuclear Genome ◽  
Evolutionary Process ◽  
Life Forms ◽  
Rbcl Gene ◽  
Evolutionary Analysis ◽  
Origin And Evolution ◽  
The Earth ◽  
Chloroplast Genomes

Chloroplasts are unique organelles within the plant cells and are responsible for sustaining life forms on the earth due to their ability to conduct photosynthesis. Multiple functional genes within the chloroplast are responsible for a variety of metabolic processes that occur in the chloroplast. Considering its fundamental role in sustaining life on the earth, it is important to identify the level of diversity present in the chloroplast genome, what genes and genomic content have been lost, what genes have been transferred to the nuclear genome, duplication events, and the overall origin and evolution of the chloroplast genome. Our analysis of 2511 chloroplast genomes indicated that the genome size and number of coding DNA sequences (CDS) in the chloroplasts genome of algae are higher relative to other lineages. Approximately 10.31% of the examined species have lost the inverted repeats (IR) in the chloroplast genome that span across all the lineages. Genome-wide analyses revealed the loss of the Rbcl gene in parasitic and heterotrophic plants occurred approximately 56 Ma ago. PsaM, Psb30, ChlB, ChlL, ChlN, and Rpl21 were found to be characteristic signature genes of the chloroplast genome of algae, bryophytes, pteridophytes, and gymnosperms; however, none of these genes were found in the angiosperm or magnoliid lineage which appeared to have lost them approximately 203–156 Ma ago. A variety of chloroplast-encoded genes were lost across different species lineages throughout the evolutionary process. The Rpl20 gene, however, was found to be the most stable and intact gene in the chloroplast genome and was not lost in any of the analyzed species, suggesting that it is a signature gene of the plastome. Our evolutionary analysis indicated that chloroplast genomes evolved from multiple common ancestors ~1293 Ma ago and have undergone vivid recombination events across different taxonomic lineages.

scholarly journals Benchmarking Oxford Nanopore read assemblers for high-quality molluscan genomes

2021 ◽  
Author(s):  
Jin Sun ◽  
Runsheng Li ◽  
Chong Chen ◽  
Julia D. Sigwart ◽  
Kevin M. Kocot
Keyword(s):  
Homo Sapiens ◽  
Phylogenomic Analysis ◽  
Model Species ◽  
High Quality ◽  
Sequencing Technologies ◽  
Oxford Nanopore ◽  
Adopted Model ◽  
Evolutionary Genomic ◽  
Long Read ◽  
Assembly Pipeline

SummaryChoosing the optimum assembly approach is essential to achieving a high-quality genome assembly suitable for comparative and evolutionary genomic investigations. Significant recent progress in long-read sequencing technologies such as PacBio and Oxford Nanopore Technologies (ONT) also brought about a large variety of assemblers. Although these have been extensively tested on model species such as Homo sapiens and Drosophila melanogaster, such benchmarking has not been done in Mollusca which lacks widely adopted model species. Molluscan genomes are notoriously rich in repeats and are often highly heterozygous, making their assembly challenging. Here, we benchmarked 10 assemblers based on ONT raw reads from two published molluscan genomes of differing properties, the gastropod Chrysomallon squamiferum (356.6Mb, 1.59% heterozygosity) and the bivalve Mytilus coruscus (1593Mb, 1.94% heterozygosity). By optimising the assembly pipeline, we greatly improved both genomes from previously published versions. Our results suggested that 40-50X of ONT reads are sufficient for high-quality genomes, with Flye being the recommended assembler for compact and less heterozygous genomes exemplified by C. squamiferum, while NextDenovo excelled for more repetitive and heterozygous molluscan genomes exemplified by M. coruscus. A phylogenomic analysis utilising the two updated genomes with other 32 published high-quality lophotrochozoan genomes resulted in maximum support across all nodes, and we show that improved genome quality also leads to more complete matrices for phylogenomic inferences. Our benchmarking will ensure the efficiency in future assemblies for molluscs and perhaps also other marine phyla with few genomes available.

scholarly journals Robust long-read native DNA sequencing using the ONT CsgG Nanopore system

2018 ◽  
Vol 2 ◽  
pp. 23 ◽  
Author(s):  
Jean-Michel Carter ◽  
Shobbir Hussain
Keyword(s):  
Dna Sequencing ◽  
Cancer Cell Line ◽  
Read Length ◽  
Nanopore Sequencing ◽  
Computational Tools ◽  
Practical Applications ◽  
Oxford Nanopore ◽  
Sequencing Method ◽  
Long Read ◽  
Oxford Nanopore Technologies

Background: The ability to obtain long read lengths during DNA sequencing has several potentially important practical applications. Especially long read lengths have been reported using the Nanopore sequencing method, currently commercially available from Oxford Nanopore Technologies (ONT). However, early reports have demonstrated only limited levels of combined throughput and sequence accuracy. Recently, ONT released a new CsgG pore sequencing system as well as a 250b/s translocation chemistry with potential for improvements. Methods: We made use of such components on ONTs miniature ‘MinION’ device and sequenced native genomic DNA obtained from the near haploid cancer cell line HAP1. Analysis of our data was performed utilising recently described computational tools tailored for nanopore/long-read sequencing outputs, and here we present our key findings. Results: From a single sequencing run, we obtained ~240,000 high-quality mapped reads, comprising a total of ~2.3 billion bases. A mean read length of 9.6kb and an N50 of ~17kb was achieved, while sequences mapped to reference with a mean identity of 85%. Notably, we obtained ~68X coverage of the mitochondrial genome and were able to achieve a mean consensus identity of 99.8% for sequenced mtDNA reads. Conclusions: With improved sequencing chemistries already released and higher-throughput instruments in the pipeline, this early study suggests that ONT CsgG-based sequencing may be a useful option for potential practical long-read applications with relevance to complex genomes.

scholarly journals Benchmarking Oxford Nanopore read assemblers for high-quality molluscan genomes

2021 ◽  
Vol 376 (1825) ◽  
Author(s):  
Jin Sun ◽  
Runsheng Li ◽  
Chong Chen ◽  
Julia D. Sigwart ◽  
Kevin M. Kocot
Keyword(s):  
Homo Sapiens ◽  
Phylogenomic Analysis ◽  
Model Species ◽  
High Quality ◽  
Sequencing Technologies ◽  
Oxford Nanopore ◽  
Adopted Model ◽  
Evolutionary Genomic ◽  
Long Read ◽  
Assembly Pipeline

Choosing the optimum assembly approach is essential to achieving a high-quality genome assembly suitable for comparative and evolutionary genomic investigations. Significant recent progress in long-read sequencing technologies such as PacBio and Oxford Nanopore Technologies (ONT) has also brought about a large variety of assemblers. Although these have been extensively tested on model species such as Homo sapiens and Drosophila melanogaster , such benchmarking has not been done in Mollusca, which lacks widely adopted model species. Molluscan genomes are notoriously rich in repeats and are often highly heterozygous, making their assembly challenging. Here, we benchmarked 10 assemblers based on ONT raw reads from two published molluscan genomes of differing properties, the gastropod Chrysomallon squamiferum (356.6 Mb, 1.59% heterozygosity) and the bivalve Mytilus coruscus (1593 Mb, 1.94% heterozygosity). By optimizing the assembly pipeline, we greatly improved both genomes from previously published versions. Our results suggested that 40–50X of ONT reads are sufficient for high-quality genomes, with Flye being the recommended assembler for compact and less heterozygous genomes exemplified by C. squamiferum , while NextDenovo excelled for more repetitive and heterozygous molluscan genomes exemplified by M. coruscus . A phylogenomic analysis using the two updated genomes with 32 other published high-quality lophotrochozoan genomes resulted in maximum support across all nodes, and we show that improved genome quality also leads to more complete matrices for phylogenomic inferences. Our benchmarking will ensure efficiency in future assemblies for molluscs and perhaps also for other marine phyla with few genomes available. This article is part of the Theo Murphy meeting issue ‘Molluscan genomics: broad insights and future directions for a neglected phylum’.

Sign in / Sign up

Export Citation Format

Share Document