scholarly journals From Normal to Obesity and Back: The Associations between Mitochondrial DNA Copy Number, Gender, and Body Mass Index

Cells ◽  
2019 ◽  
Vol 8 (5) ◽  
pp. 430 ◽  
Author(s):  
Daria Skuratovskaia ◽  
Larisa Litvinova ◽  
Maria Vulf ◽  
Pavel Zatolokin ◽  
Konstantin Popadin ◽  
...  
Keyword(s):  
Body Mass Index ◽  
Mitochondrial Dna ◽  
Body Mass ◽  
Copy Number ◽  
Buffy Coat ◽  
Control Group ◽  
Obese Patients ◽  
Mtdna Copy Number ◽  
Mitochondrial Dna Copy Number ◽  
One Year

Mitochondrial DNA (mtDNA) encodes core subunits of oxidative phosphorylation complexes and, as a result of intricate regulatory crosstalk between nuclear and mitochondrial genomes, the total number of mtDNA copies fits the requirements of each cell type. Deviations from the physiological number of mtDNA copies are expected to be deleterious and might cause some inherited diseases and normal ageing. We studied 46 obese patients with type 2 diabetes (T2DM) one year after a laparoscopic sleeve gastrectomy (LSG) and Roux-en-Y gastric bypass (RYGB). The results were compared with normal-weight patients without T2DM (control group 1) (body mass index (BMI) = 22.5 ± 3.01 kg/m2) and patients with obesity without T2DM (control group 2) (BMI = 36 ± 3.45 kg/m2). We detected an increase of mtDNA copy number in the cells of the buffy coat obtained from peripheral blood, sampled one year after bariatric surgery. We also found that average mtDNA copy number as well as its dynamics (before and after the surgery) are gender-specific. To the best of our knowledge, this is the first evidence for the restoration of mtDNA copy number in obese patients after LSG and RYGB.

31 Effect of vitrification of porcine oocytes on production of ATP and mitochondrial DNA copy number

2021 ◽  
Vol 33 (2) ◽  
pp. 123
Author(s):  
E. J. Gutierrez ◽  
F. B. Diaz ◽  
K. R. Bondioli
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Pure Water ◽  
Digital Pcr ◽  
Control Group ◽  
Atp Content ◽  
Mtdna Copy Number ◽  
Atp Production ◽  
Mitochondrial Dna Copy Number ◽  
Mitochondrial Number

This experiment evaluated the effects of vitrification at different time points of invitro maturation (IVM) on ATP production and mitochondrial DNA (mtDNA) copy number of porcine oocytes. Treatments included vitrification at 24h of IVM (V24), vitrification at 44h of IVM (V44), and a control group consisting of fresh oocytes after 48h of IVM. Porcine cumulus–oocyte complexes (COCs) were obtained from a commercial vendor and underwent the first 24h of IVM during shipment in a portable incubator. Upon arrival, COCs were randomly allocated into treatments. The oocytes in the V44 and control groups were incubated at 38.8°C and 5.5% CO2 to continue IVM. Before vitrification, COCs were denuded in hyaluronidase by vortexing, followed by 3 washes in holding medium (Hanks’ balanced salt solution–HEPES + 4% BSA). Denuded oocytes were vitrified using a 3-step, dimethyl sulfoxide (DMSO)- and ethylene glycol-based protocol (VitriCool kit, IVF Bioscience), Cryolocks as carriers, and liquid nitrogen as cryogenic agent. All steps were carried out at room temperature. Warming was achieved using the VitriWarm kit (IVF Bioscience) consisting of 4 dilution steps. After warming, the oocytes were washed in holding medium and incubated in IVM medium to complete 48h of maturation (24h for V24 and 4h for V44). All warming steps were performed at 38.5°C. Oocytes destined for ATP production assessment (Control n=26, V44 n=27, V24 n=28) were frozen in 50µL of ultra-pure water, whereas oocytes destined for mtDNA copy number quantification (Control n=32, V44 n=30, V24 n=32) were snap-frozen in ∼1µL of holding medium. Samples were kept at −80°C until further processing. The ATP content of single oocytes was determined using an ATP bioluminescent somatic cell kit (FLASC, Sigma-Aldrich). The assessment of mtDNA copy number in single oocytes was performed by amplifying the porcine Mt-ND4 gene (F atccaagcactatccatcacca, R ccgatgattacgtgcaaccc; NC_000845.1) and quantification was carried out using a Droplet Digital PCR system (Bio-Rad Laboratories). Results for ATP production and mtDNA copy number were analysed through ANOVA with Tukey’s adjustment (SAS 9.4; Sas Institute Inc.). No differences were found in mtDNA copy number among groups (Control 178 004.69±19 207.23, V44 170 483.67±18 127.18, V24 176 767.50±27 211.09; P=0.36). In contrast, all groups differed in ATP content (pg/µL) among each other (Control 26.36±4.99, V44 20.26±6.61, V24 16.54±8.07; P<0.0001). These data indicate that although there was no effect on mitochondrial number, ATP production/storage ability is significantly reduced as a result of vitrification-warming. Vitrification at 44h of IVM followed by a 4-h post-warming incubation showed the highest ATP content among the vitrification treatments.

264 MITOCHONDRIAL DNA COPY NUMBER IN OOCYTES OF PREPUBERTAL AND CYCLIC GILTS

2011 ◽  
Vol 23 (1) ◽  
pp. 230
Author(s):  
P. Pawlak ◽  
E. Pers-Kamczyc ◽  
D. Lechniak-Cieslak
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Blastocyst Stage ◽  
Developmental Competence ◽  
Published Data ◽  
Mtdna Copy Number ◽  
Final Size ◽  
Domestic Species ◽  
Mitochondrial Dna Copy Number ◽  
Wide Range

In many domestic species (pig, cow, sheep), oocytes from prepubertal females show impaired quality when compared with those from adult animals. Incomplete cytoplasmic maturation is thought to be the main factor responsible for reduced developmental competence of embryos derived from prepubertal oocytes. The status of ooplasm maturation is also reflected by the copy number of mitochondrial DNA (mtDNA). Because replication of mtDNA ceases when oocytes reach their final size and occurs again at the blastocyst stage, the mtDNA copy number is a proved marker of oocyte quality in the pig (El Shourbagy et al. 2006 Reproduction 131, 233–245). The number of mtDNA copies in the grown oocyte is crucial to sustain the first embryonic divisions. To increase the rate of good-quality blastocysts, oocytes of domestic animals have been evaluated by the brilliant cresyl blue test (BCB). According to El Shourbagy et al. (2006), more competent BCB+ oocytes possess higher copy number of mtDNA (on average 222 446) than do their BCB– counterparts (115 352). However, there are no published data on the variation in mtDNA copy number in oocytes derived from ovaries of prepubertal (NCL) and cyclic (CL) gilts. Ovaries of NCL and CL gilts were collected in a local slaughterhouse. Cumulus–oocyte complexes (COC) were aspirated from nonatretic follicles 2 to 6 mm in diameter and evaluated morphologically. Only COC with a proper morphology were subjected to the BCB test. A group of non-BCB-treated COC served as control. Four groups of COC were collected: BCB+ (CL, NCL) and control (CL, NCL). Follicular cells attached to oocytes were removed by pipetting, and completely denuded gametes were individually frozen in liquid nitrogen. Analysis of the mtDNA copy number included isolation of the total DNA followed by amplification of the Cytochrome b (CYTB) gene by real-time PCR (one copy per one mitochondrial genome). Differences in mtDNA copy number among experimental groups were evaluated by Student’s t-test. To date, 30 BCB+ oocytes have been analysed individually (15 CL and 15 NCL). The analysed parameter varied in a wide range from 79 852 to 522 712 copies in CL oocytes and from 52 270 to 287 852 copies in NCL oocytes. Oocytes from cyclic gilts contained significantly more mtDNA copies (on average 267 524) than did gametes of prepubertal females (179 339; P < 0.05). The data on the mtDNA copy number in the control oocytes are currently under investigation. The preliminary results indicate that impaired oocytes quality of prepubertal gilts may be also attributed to the reduced copy number of mtDNA. This project was sponsored by MSHE Poland (grant no. 451/N-COST/2009/0).

scholarly journals Mitochondrial DNA copy number and diabetes: the Atherosclerosis Risk in Communities (ARIC) study

2020 ◽  
Vol 8 (1) ◽  
pp. e001204
Author(s):  
Bailey DeBarmore ◽  
Ryan J Longchamps ◽  
Yiyi Zhang ◽  
Rita R Kalyani ◽  
Eliseo Guallar ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Mitochondrial Dysfunction ◽  
Copy Number ◽  
Buffy Coat ◽  
Incident Diabetes ◽  
Atherosclerosis Risk In Communities ◽  
Mitochondrial Dna Copy Number ◽  
Atherosclerosis Risk ◽  
Aric Study

IntroductionMitochondrial DNA copy number (mtDNA-CN) is a measure of mitochondrial dysfunction and is associated with diabetes in experimental models. To explore the temporality of mitochondrial dysfunction and diabetes, we estimated the prevalent and incident association of mtDNA-CN and diabetes.Research design and methodsWe assessed the associations of mtDNA-CN measured from buffy coat with prevalent and incident diabetes, stratified by race, in 8954 white and 2444 black participants in the Atherosclerosis Risk in Communities (ARIC) study, an observational cohort study. Follow-up for incident analyses was complete through visit 6, 2016.ResultsMean age at mtDNA-CN measurement was 57 years and 59% were female. Prevalence of diabetes at time of mtDNA-CN measurement was higher in blacks (563/2444, 23%) than whites (855/8954, 10%). The fully adjusted odds of prevalent diabetes for the 10th vs 90th percentile of mtDNA-CN was 1.05 (95% CI 0.74 to 1.49) among black and 1.49 (95% CI 1.20 to 1.85) among white participants. Over a median follow-up time of 19 years (Q1, Q3: 11, 24 years), we observed 617 incident diabetes cases among 1744 black and 2121 cases among 7713 white participants free of diabetes at baseline. The fully adjusted hazard of incident diabetes for the 10th vs 90th percentile of mtDNA-CN was 1.07 (95% CI 0.84 to 1.38) among black and 0.97 (95% CI 0.86 to 1.10) among white participants.ConclusionsLower mtDNA-CN in buffy coat was associated with prevalent diabetes in white but not black ARIC participants. Lower mtDNA-CN was not associated with incident diabetes over 20 years of follow-up in whites or blacks.

scholarly journals Social integration predicts mitochondrial DNA copy number in rhesus macaques

2018 ◽  
Author(s):  
Reena Debray ◽  
Noah Snyder-Mackler ◽  
Jordan Kohn ◽  
Mark Wilson ◽  
Luis Barreiro ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Social Stress ◽  
Copy Number ◽  
Rhesus Macaques ◽  
Dominance Rank ◽  
Low Rank ◽  
Mtdna Copy Number ◽  
Dna Copy Number ◽  
Chronic Social Stress ◽  
Mitochondrial Dna Copy Number

AbstractIn many social mammals, social adversity predicts compromised health and reduced fitness. These effects are thought to be driven in part by chronic social stress, but their molecular underpinnings are not well understood. Recent work suggests that chronic stress can affect mitochondrial copy number, heteroplasmy rates, and function. Here, we tested the first two possibilities, for the first time in nonhuman primates. We manipulated dominance rank in captive female rhesus macaques (n=45), where low rank induces chronic social stress, and measured mitochondrial DNA copy number and heteroplasmy in five peripheral blood mononuclear cell types from each study subject. We found no effect of dominance rank on either mtDNA copy number or heteroplasmy rates. However, grooming rates, a measure of affiliative social behavior predicted by high social status, was positively associated with mtDNA copy number in B cells, cytotoxic T cells, and monocytes. Our results suggest that social interactions can influence mtDNA regulation in immune cells. Further, they indicate the importance of considering both affiliative and competitive interactions in investigating this relationship.

scholarly journals Mitochondrial DNA Copy Number Variation Across Human Cancers

2015 ◽  
Author(s):  
Ed Reznik ◽  
Martin Miller ◽  
Yasin Senbabaoglu ◽  
Nadeem Riaz ◽  
William Lee ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number Variation ◽  
Copy Number ◽  
Large Scale ◽  
Tumor Type ◽  
Mtdna Copy Number ◽  
Tissue Samples ◽  
Mitochondrial Dna Copy Number ◽  
Number Variation ◽  
Tumor Types

In cancer, mitochondrial dysfunction, through mutations, deletions, and changes in copy number of mitochondrial DNA (mtDNA), contributes to the malignant transformation and progression of tumors. Here, we report the first large-scale survey of mtDNA copy number variation across 21 distinct solid tumor types, examining over 13,000 tissue samples profiled with next-generation sequencing methods. We find a tendency for cancers, especially of the bladder and kidney, to be significantly depleted of mtDNA, relative to matched normal tissue. We show that mtDNA copy number is correlated to the expression of mitochondrially-localized metabolic pathways, suggesting that mtDNA copy number variation reflect gross changes in mitochondrial metabolic activity. Finally, we identify a subset of tumor-type-specific somatic alterations, including IDH1 and NF1 mutations in gliomas, whose incidence is strongly correlated to mtDNA copy number. Our findings suggest that modulation of mtDNA copy number may play a role in the pathology of cancer.

scholarly journals Study on Psychiatric Evaluation of Morbidly Obese Patients

2021 ◽  
pp. 8-16
Author(s):  
Asmaa Reda Elsayed Elshazly ◽  
Mohammad Abdelhakeem Seleem ◽  
Mohamed Hamdy Abo-Ryia ◽  
Adel Abdel-Kareem Badawy
Keyword(s):  
Mental Health ◽  
Body Mass Index ◽  
Morbid Obesity ◽  
Binge Eating ◽  
Psychiatric Disorders ◽  
Body Mass ◽  
Eating Attitude ◽  
Control Group ◽  
Morbidly Obese ◽  
Obese Patients

Background: Obesity is becoming an important issue for health promotion. The World Health Organization estimated that around 1.5 billion adults were overweight (body mass index (BMI) 25 kg/m2) and about 500 million people were obese (BMI 30 kg/m2) in 2008. The relationship between obesity and mental health is also considered important. In a community-based study, obesity was positively associated with several mental disorders, especially mood disorders and anxiety disorders. The aim of the study is the assessment of current and lifetime psychiatric disorders among morbidly obese patients. Methods: This case control study was conducted on 60 participants from outpatient clinic of GIT surgery unit and community. All participants were subjected to: Body weight and body mass index, Psychiatric interview for diagnosis of psychiatric disorders by Arabic version of MINI, Scale for diagnosis of Bulimia nervosa by Shokeer, Scale for diagnosis of Anorexia Nervosa by Shokeer, Binge Eating Disorder Screener-7, Eating attitude test, Hamilton Depressions Rating Scale and Hamilton anxiety scale. Results: There was a significant increase in anxiety in patients with morbid obesity compared to control group. There was a significant difference between both groups showing the high prevalence of depression in patients with morbid obesity. Based on EAT test, there was a significant prevalence of abnormal eating behaviors in patients group compared to none of control group. A screening test for the presence of Binge eating symptoms revealed significant increase of symptoms in patients’ group. Conclusions: Psychiatric disorders are prevalent in morbidly obese patients and are associated with significantly worse quality of life. In addition, morbidly obese patients had significantly worse physical and mental health relative to control group from general population. High rates of psychiatric disorders among morbidly obese patients seem to be the rule rather than an exception.

scholarly journals Concurrent Measurement of Mitochondrial DNA Copy Number and ATP Concentration in Single Bovine Oocytes

2021 ◽  
Vol 4 (4) ◽  
pp. 88
Author(s):  
Casey C. Read ◽  
Sadikshya Bhandari ◽  
Sarah E. Moorey
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Germinal Vesicle ◽  
Mtdna Copy Number ◽  
Dna Copy Number ◽  
Metabolic Substrates ◽  
Metabolic Outcomes ◽  
Atp Concentration ◽  
Mitochondrial Dna Copy Number ◽  
Bovine Oocytes

To sustain energy-demanding developmental processes, oocytes must accumulate adequate stores of metabolic substrates and mitochondrial numbers prior to the initiation of maturation. In the past, researchers have utilized pooled samples to study oocyte metabolism, and studies that related multiple metabolic outcomes in single oocytes, such as ATP concentration and mitochondrial DNA copy number, were not possible. Such scenarios decreased sensitivity to intraoocyte metabolic relationships and made it difficult to obtain adequate sample numbers during studies with limited oocyte availability. Therefore, we developed and validated procedures to measure both mitochondrial DNA (mtDNA) copy number and ATP quantity in single oocytes. Validation of our procedures revealed that we could successfully divide oocyte lysates into quarters and measure consistent results from each of the aliquots for both ATP and mtDNA copy number. Coefficient of variation between the values retrieved for mtDNA copy number and ATP quantity quadruplicates were 4.72 ± 0.98 and 1.61 ± 1.19, respectively. We then utilized our methodology to concurrently measure mtDNA copy number and ATP quantity in germinal vesicle (GV) and metaphase two (MII) stage oocytes. Our methods revealed a significant increase in ATP levels (GV = 628.02 ± 199.53 pg, MII = 1326.24 ± 199.86 pg, p < 0.001) and mtDNA copy number (GV = 490,799.4 ± 544,745.9 copies, MII = 1,087,126.9 ± 902,202.8 copies, p = 0.035) in MII compared to GV stage oocytes. This finding is consistent with published literature and provides further validation of the accuracy of our methods. The ability to produce consistent readings and expected results from aliquots of the lysate from a single oocyte reveals the sensitivity and feasibility of using this method.

scholarly journals Mitochondrial DNA Copy Number in Cleavage Stage Human Embryos—Impact on Infertility Outcome

2022 ◽  
Vol 44 (1) ◽  
pp. 273-287
Author(s):  
Amira Podolak ◽  
Joanna Liss ◽  
Jolanta Kiewisz ◽  
Sebastian Pukszta ◽  
Celina Cybulska ◽  
...  
Keyword(s):  
Mitochondrial Dna ◽  
Copy Number ◽  
Human Reproduction ◽  
Preimplantation Embryos ◽  
Human Embryos ◽  
Embryo Morphology ◽  
Cleavage Stage ◽  
Mtdna Copy Number ◽  
Developmental Potential ◽  
Mitochondrial Dna Copy Number

A retrospective case control study was undertaken at the molecular biology department of a private center for reproductive medicine in order to determine whether any correlation exists between mitochondrial DNA (mtDNA) content of cleavage-stage preimplantation embryos and their developmental potential. A total of 69 couples underwent IVF treatment (averaged women age: 36.5, SD 4.9) and produced a total of 314 embryos. A single blastomere was biopsied from each embryo at the cleavage stage (day-3 post-fertilization) subjected to low-pass next generation sequencing (NGS), for the purpose of detecting aneuploidy. For each sample, the number of mtDNA reads obtained after analysis using NGS was divided by the number of reads attributable to the nuclear genome. The mtDNA copy number amount was found to be higher in aneuploid embryos than in those that were euploid (mean mtDNA ratio ± SD: 6.3 ± 7.5 versus 7.1 ± 5.8, p < 0.004; U Mann–Whitney test), whereas no statistically significant differences in mtDNA content were seen in relation to embryo morphology (6.6 ± 4.8 vs. 8.5 ± 13.6, p 0.09), sex (6.6 ± 4.1 vs. 6.2 ± 6.8, p 0.16), maternal age (6.9 ± 7.8 vs. 6.7 ± 4.5, p 0.14) or its ability to implant (7.4 ± 6.6 vs. 5.1 ± 4.6, p 0.18). The mtDNA content cannot serve as a useful biomarker at this point in development. However, further studies investigating both quantitative and qualitative aspects of mtDNA are still required to fully evaluate the relationship between mitochondrial DNA and human reproduction.

Abstract 388: Body Mass Index Predicts Major leeding Risks in Patients on Warfarin

2015 ◽  
Vol 35 (suppl_1) ◽  
Author(s):  
Adedotun A Ogunsua ◽  
Sunkaru Touray ◽  
Justin K Liu ◽  
Jorge Escobar ◽  
Tiffany Ip ◽  
...  
Keyword(s):  
Body Mass Index ◽  
Body Mass ◽  
Bleeding Event ◽  
Bleeding Risk ◽  
Normal Weight ◽  
Class I ◽  
Minor Bleeding ◽  
Obese Patients ◽  
Bleeding Events ◽  
One Year

Background: Despite the lack of an optimum dosing strategy in obese patients, warfarin remains the most commonly used anticoagulant. Body mass index (BMI) > 30 has been linked to increased time to obtain a therapeutic institutionalized normalized ratio (INR) on initiation of warfarin as well as higher maintenance dose. Obese patients have higher dosage requirements, however, few studies have examined the relationship between warfarin and bleeding events in these patients. Aim: We examined the performance of BMI in predicting the incidence of bleeding at an anticoagulation clinic (ACC) over a one year period. Methods: 863 patients followed in an ACC were evaluated for bleeds according to BMI over a one year period. BMI was defined as weight (kg)/height (m2). CHADS2VASC scores were calculated. Major (gastrointestinal, intracerebral and retroperitoneal hemorrhage) and minor bleeding events (epistaxis, hematuria, vaginal and skin bleeds) were ascertained. Results: 71 ( 8.2%) of the 863 patients had a bleeding event, the mean age of the cohort was 69.5 years, and 44% were females. BMI categories were normal weight (21%), overweight (38%), obese class I, (21%), II (9 %), and III (11.3%) respectively. The prevalence of major and minor bleeding events were 35.2% and 64.8% respectively. In univariate analyses, hazard ratio for major bleeding risks increased with higher obesity categories (HR 1.30, 1.85, and 1.93 for class I,II, III respectively). In multivariable adjusted model, obesity (BMI>30) significantly increased the risk of major bleeds. (HR 1.84, P<.001) (Table 1). Conclusion: Bleeding risk is higher in obese compared to normal weight individuals who are on warfarin. Risk is higher with increasing BMI. This result suggests that BMI plays a role in bleeding events in patients on warfarin. Future studies are needed to understand the mechanism by which obesity increases bleeding risk for patients on warfarin and whether similar risk exist for the novel oral anticoagulants.

scholarly journals Lower Zinc-α2-Glycoprotein Production by Adipose Tissue and Liver in Obese Patients Unrelated to Insulin Resistance

2009 ◽  
Vol 94 (11) ◽  
pp. 4499-4507 ◽  
Author(s):  
David M. Selva ◽  
Albert Lecube ◽  
Cristina Hernández ◽  
Juan A. Baena ◽  
José M. Fort ◽  
...  
Keyword(s):  
Insulin Resistance ◽  
Body Mass Index ◽  
Adipose Tissue ◽  
Body Mass ◽  
Control Group ◽  
Mrna Levels ◽  
Model Assessment ◽  
Obese Patients ◽  
Obese Subjects

Context: Zinc-α2 glycoprotein (ZAG) has been proposed as a new candidate in the pathogenesis of obesity, but most of the information stems from studies performed in rodents and in vitro assays. Objective: The main aim of the study was to compare serum levels of ZAG and its expression (mRNA levels and protein) in adipose tissue and the liver between obese and nonobese subjects. The relationship between ZAG and insulin resistance was also explored. Design: This was a case-control study. Setting: The study was conducted at a university referral center. Patients and Methods: Samples of serum, sc adipose tissue (SAT), visceral adipose tissue (VAT), and liver were obtained from 20 obese subjects during bariatric surgery. Samples from 10 nonobese patients matched by age and gender were used as a control group. Serum ZAG levels were determined by ELISA. ZAG mRNA levels were measured by real-time PCR and protein content by Western blot. The effect of insulin on liver production of ZAG was assessed using HepG2 cultures. Results: Serum concentration of ZAG (micrograms per milliliter) was significantly lower in obese subjects (40.87 ± 10.45 vs. 63.26 ± 16.40; P = 0.002). ZAG expression was significantly lower in the adipose tissue (SAT and VAT) and liver of obese patients than in control subjects. Significant negative correlations between body mass index and circulating ZAG (r = −0.65, P &lt; 0.001) as well as between body mass index and mRNA ZAG levels in SAT (r = −0.68, P &lt; 0.001) and VAT were detected (r = −0.64, P &lt; 0.001). No relationship was found between ZAG and homeostasis model assessment for insulin resistance and insulin had no effect on ZAG production in vitro. Conclusion: A down-regulation of ZAG in SAT, VAT, and liver exists in obese patients but seems unrelated to insulin resistance. A downregulation of zinc-α2 glycoprotein in adipose tissue and liver exists in obese patients, and it is unrelated to insulin resistance.

Sign in / Sign up

Export Citation Format

Share Document