scholarly journals MOLECULAR CHARACETIZATION OF TOMATO YELLOW LEAF CURL VIRUS AND FUSARIUM OXYSPORUM FORMAE SPECIALES AND RACES OF TOMATO AREAS IN NORTHERN CYPRUS

2020 ◽  
Vol 19 (3) ◽  
pp. 25-35
Author(s):  
Ayşegül ÇOLAK ATEŞ ◽  
Hakan Fidan ◽  
Bahar Gökhan
Keyword(s):  
Fusarium Oxysporum ◽  
Tomato Yellow Leaf ◽  
Molecular Techniques ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Tomato Plants ◽  
Formae Speciales ◽  
Northern Cyprus ◽  
Production Areas ◽  
Leaf Curl Virus

Fusarium oxysporum (FO) and viruses have caused wilt, root, crown rots, mosaic, yellowing and curling on tomato plants and have resulted economic yield losses on tomato production areas at Northern Cyprus (NC) in 2011–2015 years. Typical FO symptoms showing greenhouse and open field areas used for collecting 62 plants and suspected Tomato yellow leaf curl virus (TYLCV) of 76 tomato plants have been studied respectively. In the researches, four different primers (uni, sp 13, sp 23, sprl) were used to determine the formae speciales and races of 62 isolates of FO isolates from different locations. PCR analyse studies have revealed that 81% of collected samples were Fusarium oxysporum f.sp. lycopersici (FOL) and 19% of them were Fusarium oxysporum f.sp. radicis-lycopersici (FORL). Additionally, further PCR analyses have identified that 37% of FOL samples were race 1, 15% were race 2 and 29% were race 3 identified respectively. The different samples of 76 tomato plants were tested with specific primers in PCR amplifications. Their results determined that the strains TYLCV-Israel, TYLCV-Sicilia, TYLCV-Mild of TYLCV found. The molecular techniques have suggested that Israel, Sicilia and Mild strain of TYLCV were present in the tomato production areas at NC. The TYLCV races with single or mixed infections and Fusarium oxysporum formae speciales and races are able to identify in molecular techniques in not only accurately but also reliably.

scholarly journals Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1017-1017 ◽  
Author(s):  
G. Anfoka ◽  
F. Haj Ahmad ◽  
M. Altaleb ◽  
M. Al Shhab
Keyword(s):  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Single Infection ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Tomato Plants ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

scholarly journals Introduction of the Exotic Monopartite Tomato yellow leaf curl virus into West Coast Mexico

Plant Disease ◽  
2006 ◽  
Vol 90 (10) ◽  
pp. 1360-1360 ◽  
Author(s):  
J. K. Brown ◽  
A. M. Idris
Keyword(s):  
United States ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Caribbean Region ◽  
Yellow Leaf ◽  
Fresh Market ◽  
Tomato Production ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

Leaf curl symptoms that are reminiscent of begomovirus (genus Begomovirus, family Geminiviridae) infection were observed widespread in the tomato crop during the early fall 2005 through the spring 2006 growing seasons in Sinaloa State, Mexico. Symptoms were widespread in three major valleys (Culiacan, Guasave, and Los Mochis) that are largely dedicated to fresh-market tomato production for the U.S. market from October to June. Symptoms included stunting of leaves, shortened internodes, distortion of leaf margins, and green vein banding. Fruit set was reduced significantly (as much as 90%) on the portion of the plant that developed above the point of symptom expression. Tomato fields were heavily infested with the B biotype of the whitefly Bemisia tabaci (Genn.) vector and no other insect vectors were noted in the fields. Total DNA was extracted from six symptomatic tomato plants (two from each valley) and used as template to amplify, clone, and sequence the core region of the begomovirus CP. BLAST analysis of begomovirus sequences available in the NCBI GenBank database indicated the closest match was the Old World monopartite begomovirus Tomato yellow leaf curl virus (TYLCV) from Israel (Accession No. X15656) at 97.8% shared nucleotide (nt) identity. The full-length genome was amplified for each of six isolates using TempliPhi (Amersham Biosciences, Piscataway, NJ) and cloned into the pGEM7 vector (Promega, Madison, WI). The complete DNA genome sequence was determined for eight clones by primer walking. Cloned TempliPhi products sequenced represented two to three isolates from each valley. Results indicated that the isolates (n = 8) were 98.9 to 100% identical (Accession No. DQ631892) to each other, and they shared 98% identity with TYLCV isolates reported from the Caribbean Region and Florida. This highly virulent begomovirus of tomato, originating in Israel, was first reported in Mexico from 1996 to 1997 when it was identified in tomato plants in the Yucatan Peninsula (1) (>1,500 miles from Sinaloa). The latter report followed the introduction of TYLCV in tomato seedlings from Florida into several eastern U.S. states (3,4) and then into Puerto Rico (2). The introduction of TYLCV into Sinaloa where tomato production is highly concentrated is significant because the region supplies the majority (as much as 93%) of fresh-market tomatoes to the western United States from October to June (>$750 million dollars). Of equal importance is the immediate proximity of the pandemic to California where more than 90% of the processing tomatoes in the United States are grown. References: (1) J. T. Ascencio-Ibáñez et al. Plant Dis. 83:1178, 1999. (2) J. Bird et al. Plant Dis. 85:1028, 2001. (3) M. T. Momol et al. Plant Dis 83:487, 1999. (4) J. E. Polston and P. K. Anderson, Plant Dis. 81:1358, 1997.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan
Keyword(s):  
Amino Acids ◽  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Plant Interactions ◽  
Tomato Plants ◽  
Individual Host ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

Interaction between ‘Candidatus Phytoplasma australasiae’ and Tomato yellow leaf curl virus in tomato plants

2020 ◽  
Vol 158 (3) ◽  
pp. 733-744
Author(s):  
Nazanin Ebadi ◽  
Gilda Najafipour ◽  
Mohammad Mehdi Faghihi ◽  
Kavous Ayazpour ◽  
Mohammad Salehi
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Rate of Tomato yellow leaf curl virus Translocation in the Circulative Transmission Pathway of its Vector, the Whitefly Bemisia tabaci

2001 ◽  
Vol 91 (2) ◽  
pp. 188-196 ◽  
Author(s):  
Murad Ghanim ◽  
Shai Morin ◽  
Henryk Czosnek
Keyword(s):  
Salivary Glands ◽  
Bemisia Tabaci ◽  
Virus Genome ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Hemolymph Sample ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whiteflies (Bemisia tabaci, biotype B) were able to transmit Tomato yellow leaf curl virus (TYLCV) 8 h after they were caged with infected tomato plants. The spread of TYLCV during this latent period was followed in organs thought to be involved in the translocation of the virus in B. tabaci. After increasing acquisition access periods (AAPs) on infected tomato plants, the stylets, the head, the midgut, a hemolymph sample, and the salivary glands dissected from individual insects were subjected to polymerase chain reaction (PCR) without any treatment; the presence of TYLCV was assessed with virus-specific primers. TYLCV DNA was first detected in the head of B. tabaci after a 10-min AAP. The virus was present in the midgut after 40 min and was first detected in the hemolymph after 90 min. TYLCV was found in the salivary glands 5.5 h after it was first detected in the hemolymph. Subjecting the insect organs to immunocapture-PCR showed that the virus capsid protein was in the insect organs at the same time as the virus genome, suggesting that at least some TYLCV translocates as virions. Although females are more efficient as vectors than males, TYLCV was detected in the salivary glands of males and of females after approximately the same AAP.

scholarly journals Use of Tomato yellow leaf curl virus (TYLCV) Rep Gene Sequences to Engineer TYLCV Resistance in Tomato

2004 ◽  
Vol 94 (5) ◽  
pp. 490-496 ◽  
Author(s):  
Y. Yang ◽  
T. A. Sherwood ◽  
C. P. Patte ◽  
E. Hiebert ◽  
J. E. Polston
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gene Sequences ◽  
Tomato Production ◽  
Challenge Inoculation ◽  
Biolistic Inoculation ◽  
Polymerase Chain ◽  
The Tropics ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), Δ2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and RepΔ2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to Δ2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

Sign in / Sign up

Export Citation Format

Share Document