scholarly journals Cell wall localization of the aspartic proteinase from buckwheat (FeAPL1) over-expressed in tobacco BY-2 cells

2011 ◽  
Vol 76 (9) ◽  
pp. 1229-1236 ◽  
Author(s):  
Mira Milisavljevic ◽  
Gordana Timotijevic ◽  
Dragana Nikolic ◽  
Jelena Samardzic ◽  
Vesna Maksimovic
Keyword(s):  
Cell Wall ◽  
Enzymatic Activity ◽  
Cell Line ◽  
Blot Analysis ◽  
Aspartic Proteinase ◽  
Potential Functions ◽  
Protein Gel ◽  
Pepstatin A

The recombinant aspartic proteinase-like protein (FeAPL1-His6) was overexpressed in the tobacco BY-2 cell line and the expected pepstatin A-sensitive enzymatic activity was confirmed at pH 3.0. Immunocytochemistry and protein gel blot analysis of the transformed BY-2 cells and their protoplasts showed extracellular localization of rFeAPL1-His6 in the cell wall. Based on the obtained results, potential functions of FeAPL1 are discussed.

Protein gel blot analysis

2007 ◽  
Author(s):  
Dominique Loqué ◽  
Wolf Frommer
Keyword(s):  
Blot Analysis ◽  
Protein Gel

Synthesis and Characterization of Quinoline-3-Carboxamide Derivatives as Inhibitors of the ATM Kinase

2020 ◽  
Vol 20 (23) ◽  
pp. 2070-2079
Author(s):  
Srimadhavi Ravi ◽  
Sugata Barui ◽  
Sivapriya Kirubakaran ◽  
Parul Duhan ◽  
Kaushik Bhowmik
Keyword(s):  
Western Blot ◽  
Cancer Cells ◽  
Cell Line ◽  
Cell Lines ◽  
Cancer Cell ◽  
Blot Analysis ◽  
Western Blot Analysis ◽  
Cancer Cell Lines ◽  
Atm Kinase ◽  
Cytotoxicity Studies

Background: The importance of inhibiting the kinases of the DDR pathway for radiosensitizing cancer cells is well established. Cancer cells exploit these kinases for their survival, which leads to the development of resistance towards DNA damaging therapeutics. Objective: In this article, the focus is on targeting the key mediator of the DDR pathway, the ATM kinase. A new set of quinoline-3-carboxamides, as potential inhibitors of ATM, is reported. Methods: Quinoline-3-carboxamide derivatives were synthesized and cytotoxicity assay was performed to analyze the effect of molecules on different cancer cell lines like HCT116, MDA-MB-468, and MDA-MB-231. Results: Three of the synthesized compounds showed promising cytotoxicity towards a selected set of cancer cell lines. Western Blot analysis was also performed by pre-treating the cells with quercetin, a known ATM upregulator, by causing DNA double-strand breaks. SAR studies suggested the importance of the electron-donating nature of the R group for the molecule to be toxic. Finally, Western-Blot analysis confirmed the down-regulation of ATM in the cells. Additionally, the PTEN negative cell line, MDA-MB-468, was more sensitive towards the compounds in comparison with the PTEN positive cell line, MDA-MB-231. Cytotoxicity studies against 293T cells showed that the compounds were at least three times less toxic when compared with HCT116. Conclusion: In conclusion, these experiments will lay the groundwork for the evolution of potent and selective ATM inhibitors for the radio- and chemo-sensitization of cancer cells.

Essential role for cathepsin D in bleomycin-induced apoptosis of alveolar epithelial cells

2004 ◽  
Vol 287 (1) ◽  
pp. L46-L51 ◽  
Author(s):  
Xiaopeng Li ◽  
Heather Rayford ◽  
Ruijie Shu ◽  
Jiaju Zhuang ◽  
Bruce D. Uhal
Keyword(s):  
Enzymatic Activity ◽  
Cathepsin D ◽  
Alveolar Epithelial Cells ◽  
Type Ii ◽  
Ang Ii ◽  
Nuclear Fragmentation ◽  
Alveolar Epithelial ◽  
Induced Apoptosis ◽  
Pepstatin A

Our earlier studies showed that bleomycin-induced apoptosis of type II alveolar epithelial cells (AECs) requires the autocrine synthesis and proteolytic processing of angiotensinogen into ANG II and that inhibitors of ANG-converting enzyme (ACEis) block bleomycin-induced apoptosis (Li X, Zhang H, Soledad-Conrad V, Zhuang J, and Uhal BD. Am J Physiol Lung Cell Mol Physiol 284: L501–L507, 2003). Given the documented role of cathepsin D (CatD) in apoptosis of other cell types, we hypothesized that CatD might be the AEC enzyme responsible for the conversion of angiotensinogen into ANG I, the substrate for ACE. Primary cultures of rat type II AECs challenged with bleomycin in vitro showed upregulation and secretion of CatD enzymatic activity and immunoreactive protein but no increases in CatD mRNA. The aspartyl protease inhibitor pepstatin A, which completely blocked CatD enzymatic activity, inhibited bleomycin-induced nuclear fragmentation by 76% and reduced bleomycin-induced caspase-3 activation by 47%. Antisense oligonucleotides against CatD mRNA reduced CatD-immunoreactive protein and inhibited bleomycin-induced nuclear fragmentation by 48%. A purified fragment of angiotensinogen (F1–14) containing the CatD and ACE cleavage sites, when applied to unchallenged AEC in vitro, yielded mature ANG II peptide and induced apoptosis. The apoptosis induced by F1–14 was inhibited 96% by pepstatin A and 77% by neutralizing antibodies specific for CatD (both P < 0.001). These data indicate a critical role for CatD in bleomycin-induced apoptosis of cultured AEC and suggest that the role(s) of CatD in AEC apoptosis include the conversion of newly synthesized angiotensinogen to ANG II.

scholarly journals Characterization of naturally Epstein–Barr virus-infected gastric carcinoma cell line YCCEL1

2013 ◽  
Vol 94 (3) ◽  
pp. 497-506 ◽  
Author(s):  
Do Nyun Kim ◽  
Min Koo Seo ◽  
Hoyun Choi ◽  
Su Yeon Kim ◽  
Hee Jong Shin ◽  
...  
Keyword(s):  
Cell Line ◽  
Cell Lines ◽  
Blot Analysis ◽  
Epstein Barr Virus ◽  
Model Systems ◽  
Nuclear Antigen ◽  
Gastric Carcinoma Cell ◽  
Barr Virus ◽  
Epstein Barr

Epstein–Barr virus (EBV) is a herpesvirus associated with lymphomas and carcinomas. While EBV-associated epithelial cell lines are good model systems to investigate the role of EBV in carcinoma, only a few cell lines are available as they are hard to acquire. A greater variety of naturally EBV-infected cell lines which are derived from tumour patients are needed to represent various features of EBVaGC. We characterized cell line YCCEL1, established from a Korean EBVaGC patient, to ascertain whether it can be used to study the roles of EBV in EBVaGC. The expression of EBV genes and cell surface markers was examined by in situ hybridization, RT-PCR, Western blot analysis, immunofluorescence assay and Northern blot analysis. EBV episomal status was analysed by Southern blotting and real-time PCR. This cell line expressed EBV nuclear antigen 1 (EBNA1) and latent membrane protein 2A (LMP2A), but not EBNA2, LMP2B nor LMP1. The majority of the lytic proteins were not detected in YCCEL1 cells either before or after treatment with 12-O-tetradecanoylphorbol-13-acetate. YCCEL1 cells expressed BART microRNAs (miRNAs) at high level but did not express BHRF1 miRNAs. YCCEL1 cells expressed cytokeratin, but not CD21 and CD19, suggesting CD21-independent EBV infection. The latent EBV gene and EBV miRNA expression pattern of YCCEL1 cells closely resembled that of general EBVaGC cases. Our results support the value of YCCEL1 cells as a good model system to study the role of EBV in gastric carcinogenesis.

scholarly journals Differentiation of propeptide residues regulating the compartmentalization, maturation and activity of the broad-range phospholipase C of Listeria monocytogenes

2010 ◽  
Vol 432 (3) ◽  
pp. 557-566 ◽  
Author(s):  
Emily R. Slepkov ◽  
Alan Pavinski Bitar ◽  
Hélène Marquis
Keyword(s):  
Cell Wall ◽  
Listeria Monocytogenes ◽  
Amino Acid ◽  
Enzymatic Activity ◽  
Phospholipase C ◽  
Bacterial Pathogen ◽  
Amino Acid Residues ◽  
C Terminus ◽  
N Terminus ◽  
Vacuolar Acidification

The intracellular bacterial pathogen Listeria monocytogenes secretes a broad-range phospholipase C enzyme called PC-PLC (phosphatidylcholine phospholipase C) whose compartmentalization and enzymatic activity is regulated by a 24-amino-acid propeptide (Cys28–Ser51). During intracytosolic multiplication, bacteria accumulate the proform of PC-PLC at their membrane–cell-wall interface, whereas during cell-to-cell spread vacuolar acidification leads to maturation and rapid translocation of PC-PLC across the cell wall in a manner that is dependent on Mpl, the metalloprotease of Listeria. In the present study, we generated a series of propeptide mutants to determine the minimal requirement to prevent PC-PLC enzymatic activity and to identify residues regulating compartmentalization and maturation. We found that a single residue at position P1 (Ser51) of the cleavage site is sufficient to prevent enzymatic activity, which is consistent with P1′ (Trp52) being located within the active-site pocket. We observed that mutants with deletions at the N-terminus, but not the C-terminus, of the propeptide are translocated across the cell wall more effectively than wild-type PC-PLC at a physiological pH, and that individual amino acid residues within the N-terminus influence Mpl-mediated maturation of PC-PLC at acidic pH. However, deletion of more than 75% of the propeptide was required to completely prevent Mpl-mediated maturation of PC-PLC. These results indicate that the N-terminus of the propeptide regulates PC-PLC compartmentalization and that specific residues within the N-terminus influence the ability of Mpl to mediate PC-PLC maturation, although a six-residue propeptide is sufficient for Mpl to mediate PC-PLC maturation.

Methanolic Extract of Cynara Cardunculus L. Inhibits Cell Proliferation and Bcr/Abl Expression in K562 Cell Line

Blood ◽  
2008 ◽  
Vol 112 (11) ◽  
pp. 4247-4247
Author(s):  
Antonio Russo ◽  
Filomena Conforti ◽  
Maria Cristina Caroleo ◽  
Roberta Ionà ◽  
Giancarlo Statti ◽  
...  
Keyword(s):  
Cell Growth ◽  
Western Blot ◽  
Cell Line ◽  
Blot Analysis ◽  
Proliferative Activity ◽  
Methanolic Extract ◽  
Mrna Levels ◽  
Cynara Cardunculus ◽  
Rt Pcr ◽  
K562 Cell Line

Abstract Introduction: Chronic myeloid leukaemia (CML) is a myeloid neoplasm defined by the Bcr/Abl oncoprotein that is considered essential for leukaemogenesis and accumulation of neoplastic cells. Evidence exists showing that extracts of antichoke Cynara cardunculus L. (CCE) are able to inhibit cancer cell growth in vitro (1). In the present study we have investigated the antiproliferative effect of methanolic extract of CEE on K562 Bcr-Abl positive leukemia cell line. In addition we evaluated whether the extract of CEE also affects the mRNA levels of Bcr-Abl and p210 expression in this cell line. Materials and Methods: Preparation of methanolic extract of CEE. The aerial parts of CEE were air dried until dryness at room temperature, cut into small pieces and then extracted with methanol through maceration (48 h for 3 times). The resultant total extracts were dried under reduced pressure and their weight was determined. Cell culture. The K562 cells were grown in RPMI 1640 with L-glutamine supplemented with 10% (v/v) heat-inactivated FBS, 1% penicillin/streptomycin in humidified atmosphere of 5% CO2 at 37°C. In all experiments growing cells at optimal concentration were placed in 24 or 96 well plate and then treated with vehicle or 5–100–200 μg/ml methanolic extract of CEE. 48h after the treatment cultures were tested for proliferative activity, mRNA level of Bcr-Abl by RT-PCR and p210 protein expression by western blotting analysis. Proliferative activity. Proliferative activity was determined using the MTT technique according to the method described by Tubaro et al. (1996). The assay was performed in triplicate and absorbance values at 550 nm were measured using a microplate reader. RT-PCR Analysis. The total cellular mRNA was isolated from treated and control cells using an silica coloumns. Using equal amounts of the RNA from each sample, the cDNA was synthesized by Superscript VILO™ cDNA kit. PCR was performed using Platinum® Taq DNA polymerase and specific primers for t(9;22) p210 transcripts (b3a2): GAAGTGTTTCAGAAGCTTTCC (sense) and GTTTGGGCT-TCACACCATTCC (antisense). 35 amplification cycles were performed at 94°C for 30s, 55°C for 30s and 72°C for 1min. Gel electrophoresis and ethidium bromide staining was used to visualize the PCR products. Western Blot Analysis. Cell pellets from control and treated cultures were lysed using lysis buffer with protease and phosphatase inhibitors. The proteins were then quantified and equal amounts (30 ug) were separated by SDS-PAGE and electro-blotted to nitrocellulose. After blocking procedure the blots were incubated with specific primary antibody against p210 protein and then challenged with specific horseradish peroxidase-conjugated secondary antibody. The reactive protein was visualized using an enhanced chemiluminescence detection system. Results: The results have shown that treatment of K562 cell line with methanolic extract of CEE reduced cell viability in a dose-dependent fashion (IC50=41.7 μg/ml) as demonstrated by MTT assay. PCR and Western blot analysis revealed that the cell growth inhibition was associated to a dramatic decrease of mRNA levels of Bcr-Abl and to a significant reduction of p210 protein expression suggesting that the antiproliferative effect of methanolic extract of CEE likely due to the inhibition at transcriptional level of Bcr-Abl oncoprotein. Further studies are needed to better elucidate this mechanisms and to identify the compound of crude extract which is responsible of cancer growth suppression.

1,25-Dihydroxyvitamin D3 Induces Differentiation of a Retinoic Acid–Resistant Acute Promyelocytic Leukemia Cell Line (UF-1) Associated With Expression of p21WAF1/CIP1 and p27KIP1

Blood ◽  
1999 ◽  
Vol 93 (7) ◽  
pp. 2225-2233 ◽  
Author(s):  
Akihiro Muto ◽  
Masahiro Kizaki ◽  
Kenji Yamato ◽  
Yohko Kawai ◽  
Maiko Kamata-Matsushita ◽  
...  
Keyword(s):  
Retinoic Acid ◽  
Cell Line ◽  
Acute Promyelocytic Leukemia ◽  
Northern Blot ◽  
Blot Analysis ◽  
Northern Blot Analysis ◽  
Promyelocytic Leukemia ◽  
G1 Arrest ◽  
Dihydroxyvitamin D3 ◽  
1,25 Dihydroxyvitamin D3

Retinoic acid (RA) resistance is a serious problem for patients with acute promyelocytic leukemia (APL) who are receiving all-transRA. However, the mechanisms and strategies to overcome RA resistance by APL cells are still unclear. The biologic effects of RA are mediated by two distinct families of transcriptional factors: RA receptors (RARs) and retinoid X receptors (RXRs). RXRs heterodimerize with 1,25-dihydroxyvitamin D3[1,25(OH)2D3] receptor (VDR), enabling their efficient transcriptional activation. The cyclin-dependent kinase (cdk) inhibitor p21WAF1/CIP1 has a vitamin D3–responsive element (VDRE) in its promoter, and 1,25(OH)2D3 enhances the expression of p21WAF1/CIP1 and induces differentiation of selected myeloid leukemic cell lines. We have recently established a novel APL cell line (UF-1) with features of RA resistance. 1,25(OH)2D3 can induce growth inhibition and G1 arrest of UF-1 cells, resulting in differentiation of these cells toward granulocytes. This 1,25(OH)2D3-induced G1 arrest is enhanced by all-trans RA. Also, 1,25(OH)2D3 (10−10 to 10−7 mol/L) in combination with RA markedly inhibits cellular proliferation in a dose- and time-dependent manner. Associated with these findings, the levels of p21WAF1/CIP1 and p27KIP1 mRNA and protein increased in these cells. Northern blot analysis showed that p21WAF1/CIP1 and p27KIP1 mRNA and protein increased in these cells. Northern blot analysis showed that p21WAF1/CIP1 and p27KIP1 transcripts were induced after 6 hours’ exposure to 1,25(OH)2D3 and then decreased to basal levels over 48 hours. Western blot experiments showed that p21WAF1/CIP1 protein levels increased and became detectable after 12 hours of 1,25(OH)2D3treatment and induction of p27KIP1 protein was much more gradual and sustained in UF-1 cells. Interestingly, the combination of 1,25(OH)2D3 and RA markedly enhanced the levels of p27KIP1 transcript and protein as compared with levels induced by 1,25(OH)2D3 alone. In addition, exogenous p27KIP1 expression can enhance the level of CD11b antigen in myeloid leukemic cells. In contrast, RA alone can induce G1 arrest of UF-1 cells; however, it did not result in an increase of p21WAF1/CIP1 and p27KIP1transcript and protein expression in RA-resistant cells. Taken together, we conclude that 1,25(OH)2D3 induces increased expression of cdk inhibitors, which mediates a G1 arrest, and this may be associated with differentiation of RA-resistant UF-1 cells toward mature granulocytes.

The sea urchin egg yolk granule is a storage compartment for HCL-32, an extracellular matrix protein

1998 ◽  
Vol 76 (1) ◽  
pp. 83-88 ◽  
Author(s):  
Janice Mayne ◽  
John J Robinson
Keyword(s):  
Extracellular Matrix ◽  
Sea Urchin ◽  
Blot Analysis ◽  
Extracellular Matrix Protein ◽  
Yolk Granule ◽  
Cortical Granules ◽  
Yolk Granules ◽  
Storage Compartment ◽  
Protein Gel ◽  
Stage Of Development

We have utilized protein gel blot analysis and immunogold labelling to define the intracellular storage compartment for HCL-32, a 32-kDa protein component of the sea urchin embryonic extracellular matrices, the hyaline layer and basal lamina. Anti-HCL-32 antiserum specifically labelled yolk granules in unfertilized eggs. Cortical granules, mitochondria, sparse granules, and lipid vacuoles were not labelled. Label continued to be detected in the yolk granules through to the blastula stage of development. However, by the gastrula stage no labelling was detected in the yolk granules. In protein gel blot analysis HCL-32 was detected in yolk granules prepared from unfertilized eggs. These results clearly define the yolk granule as a storage compartment for HCL-32, an extracellular matrix protein.Key words: embryo, yolk granule, extracellular matrix.

Sign in / Sign up

Export Citation Format

Share Document