scholarly journals The Development of Pathogenicity of Avian Influenza Virus Isolated from Indonesia

2015 ◽  
Vol 18 (2) ◽  
pp. 133
Author(s):  
Michael Haryadi Wibowo ◽  
Agus Eko Srihanto ◽  
Khrisdiana Putri ◽  
Widya Asmara ◽  
Charles Rangga Tabbu
Keyword(s):  
Amino Acid ◽  
Cleavage Site ◽  
Virus Detection ◽  
Basic Amino Acid ◽  
Nucleotide Composition ◽  
Rt Pcr ◽  
Highly Pathogenic ◽  
Viral Stock ◽  
Fusion Site ◽  
Pcr Method

Highly pathogenic avian infl uenza outbreak in Indonesia has been reported in various poultry due toH5N1 subtype. The presence of multiple basic amino acids within the cleavage site of HA glycoprotein hasbeen identifi ed to be associated with the pathogenicity of avian infl uenza virus. The study was retrospectivestudy which was designed to characterize the cleavage site and fusion site region of haemagglutinin gene ofAIV isolated from various poultry in 2003 to 2013. Isolation, Identifi cation and propagation were carried outto collect viral stock. For virus detection, reverse transcriptase PCR (RT-PCR) method on H5 and N1 genefragment was performed. All of RT-PCR HA gene positive products were sequenced for further nucleotideanalysis and to determine the nucleotide composition at the targeted fragment. The results are all AIV isolateswere identifi ed as H5N1 subtype. The sequence analyses revealed some motives of basic amino acid motivethat were classifi ed as highly pathogenic avian infl uenza virus. Further analyses on fusion domain of all AIVisolated during the period 2003 to 2013 showed conserved amino acid. Keywords: avian infl uenza, haemagglutinin, cleavage site, basic amino acid, fusion site

scholarly journals H5N2 Avian Influenza Outbreak in Texas in 2004: the First Highly Pathogenic Strain in the United States in 20 Years?

2005 ◽  
Vol 79 (17) ◽  
pp. 11412-11421 ◽  
Author(s):  
Chang-Won Lee ◽  
David E. Swayne ◽  
Jose A. Linares ◽  
Dennis A. Senne ◽  
David L. Suarez
Keyword(s):  
United States ◽  
Amino Acid ◽  
Avian Influenza ◽  
Cleavage Site ◽  
Basic Amino Acid ◽  
The United States ◽  
Influenza Viruses ◽  
Single Point Mutation ◽  
Highly Pathogenic

ABSTRACT In early 2004, an H5N2 avian influenza virus (AIV) that met the molecular criteria for classification as a highly pathogenic AIV was isolated from chickens in the state of Texas in the United States. However, clinical manifestations in the affected flock were consistent with avian influenza caused by a low-pathogenicity AIV and the representative virus (A/chicken/Texas/298313/04 [TX/04]) was not virulent for experimentally inoculated chickens. The hemagglutinin (HA) gene of the TX/04 isolate was similar in sequence to A/chicken/Texas/167280-4/02 (TX/02), a low-pathogenicity AIV isolate recovered from chickens in Texas in 2002. However, the TX/04 isolate had one additional basic amino acid at the HA cleavage site, which could be attributed to a single point mutation. The TX/04 isolate was similar in sequence to TX/02 isolate in several internal genes (NP, M, and NS), but some genes (PA, PB1, and PB2) had sequence of a clearly different origin. The TX/04 isolate also had a stalk deletion in the NA gene, characteristic of a chicken-adapted AIV. By analyzing viruses constructed by in vitro mutagenesis followed by reverse genetics, we found that the pathogenicity of the TX/04 virus could be increased in vitro and in vivo by the insertion of an additional basic amino acid at the HA cleavage site and not by the loss of a glycosylation site near the cleavage site. Our study provides the genetic and biologic characteristics of the TX/04 isolate, which highlight the complexity of the polygenic nature of the virulence of influenza viruses.

scholarly journals The Emergence of H7N7 Highly Pathogenic Avian Influenza Virus from Low Pathogenicity Avian Influenza Virus Using an in ovo Embryo Culture Model

Viruses ◽  
2020 ◽  
Vol 12 (9) ◽  
pp. 920
Author(s):  
Amanda Seekings ◽  
Wendy Howard ◽  
Alejandro Nuñéz ◽  
Marek Slomka ◽  
Ashley Banyard ◽  
...  
Keyword(s):  
Influenza Virus ◽  
Amino Acid ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Cleavage Site ◽  
Highly Pathogenic Avian Influenza ◽  
Basic Amino Acid ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Pathogenic Avian Influenza Virus

Outbreaks of highly pathogenic avian influenza virus (HPAIV) often result in the infection of millions of poultry, causing up to 100% mortality. HPAIV has been shown to emerge from low pathogenicity avian influenza virus (LPAIV) in field outbreaks. Direct evidence for the emergence of H7N7 HPAIV from a LPAIV precursor with a rare di-basic cleavage site (DBCS) was identified in the UK in 2008. The DBCS contained an additional basic amino acid compared to commonly circulating LPAIVs that harbor a single-basic amino acid at the cleavage site (SBCS). Using reverse genetics, outbreak HPAIVs were rescued with a DBCS (H7N7DB), as seen in the LPAIV precursor or an SBCS representative of common H7 LPAIVs (H7N7SB). Passage of H7N7DB in chicken embryo tissues showed spontaneous evolution to a HPAIV. In contrast, deep sequencing of extracts from embryo tissues in which H7N7SB was serially passaged showed retention of the LPAIV genotype. Thus, in chicken embryos, an H7N7 virus containing a DBCS appears naturally unstable, enabling rapid evolution to HPAIV. Evaluation in embryo tissue presents a useful approach to study AIV evolution and allows a laboratory-based dissection of molecular mechanisms behind the emergence of HPAIV.

scholarly journals Genetic Predisposition To Acquire a Polybasic Cleavage Site for Highly Pathogenic Avian Influenza Virus Hemagglutinin

mBio ◽  
2017 ◽  
Vol 8 (1) ◽  
Author(s):  
Naganori Nao ◽  
Junya Yamagishi ◽  
Hiroko Miyamoto ◽  
Manabu Igarashi ◽  
Rashid Manzoor ◽  
...  
Keyword(s):  
Amino Acid ◽  
Cleavage Site ◽  
Influenza A ◽  
Basic Amino Acid ◽  
Viral Rna ◽  
Amino Acid Residues ◽  
Influenza A Viruses ◽  
Highly Pathogenic ◽  
Multiple Basic Amino Acid ◽  
Nucleotide Insertions

ABSTRACT Highly pathogenic avian influenza viruses with H5 and H7 hemagglutinin (HA) subtypes evolve from low-pathogenic precursors through the acquisition of multiple basic amino acid residues at the HA cleavage site. Although this mechanism has been observed to occur naturally only in these HA subtypes, little is known about the genetic basis for the acquisition of the polybasic HA cleavage site. Here we show that consecutive adenine residues and a stem-loop structure, which are frequently found in the viral RNA region encoding amino acids around the cleavage site of low-pathogenic H5 and H7 viruses isolated from waterfowl reservoirs, are important for nucleotide insertions into this RNA region. A reporter assay to detect nontemplated nucleotide insertions and deep-sequencing analysis of viral RNAs revealed that an increased number of adenine residues and enlarged stem-loop structure in the RNA region accelerated the multiple adenine and/or guanine insertions required to create codons for basic amino acids. Interestingly, nucleotide insertions associated with the HA cleavage site motif were not observed principally in the viral RNA of other subtypes tested (H1, H2, H3, and H4). Our findings suggest that the RNA editing-like activity is the key mechanism for nucleotide insertions, providing a clue as to why the acquisition of the polybasic HA cleavage site is restricted to the particular HA subtypes. IMPORTANCE Influenza A viruses are divided into subtypes based on the antigenicity of the viral surface glycoproteins hemagglutinin (HA) and neuraminidase. Of the 16 HA subtypes (H1 to -16) maintained in waterfowl reservoirs of influenza A viruses, H5 and H7 viruses often become highly pathogenic through the acquisition of multiple basic amino acid residues at the HA cleavage site. Although this mechanism has been known since the 1980s, the genetic basis for nucleotide insertions has remained unclear. This study shows the potential role of the viral RNA secondary structure for nucleotide insertions and demonstrates a key mechanism explaining why the acquisition of the polybasic HA cleavage site is restricted to particular HA subtypes in nature. Our findings will contribute to better understanding of the ecology of influenza A viruses and will also be useful for the development of genetically modified vaccines against H5 and H7 influenza A viruses with increased stability. IMPORTANCE Influenza A viruses are divided into subtypes based on the antigenicity of the viral surface glycoproteins hemagglutinin (HA) and neuraminidase. Of the 16 HA subtypes (H1 to -16) maintained in waterfowl reservoirs of influenza A viruses, H5 and H7 viruses often become highly pathogenic through the acquisition of multiple basic amino acid residues at the HA cleavage site. Although this mechanism has been known since the 1980s, the genetic basis for nucleotide insertions has remained unclear. This study shows the potential role of the viral RNA secondary structure for nucleotide insertions and demonstrates a key mechanism explaining why the acquisition of the polybasic HA cleavage site is restricted to particular HA subtypes in nature. Our findings will contribute to better understanding of the ecology of influenza A viruses and will also be useful for the development of genetically modified vaccines against H5 and H7 influenza A viruses with increased stability.

scholarly journals Development of a real-time RT-PCR method for the detection of newly emerged highly pathogenic H7N9 influenza viruses

2017 ◽  
Vol 16 (9) ◽  
pp. 2055-2061 ◽  
Author(s):  
Xiu-rong WANG ◽  
Lin-lin GU ◽  
Jian-zhong SHI ◽  
Hai-feng XU ◽  
Ying ZHANG ◽  
...  
Keyword(s):  
Real Time ◽  
Influenza Viruses ◽  
Rt Pcr ◽  
Highly Pathogenic ◽  
Pcr Method ◽  
H7n9 Influenza

Development of a highly sensitive nested RT-PCR method for Beet necrotic yellow vein virus detection

2001 ◽  
Vol 95 (1-2) ◽  
pp. 163-169 ◽  
Author(s):  
J Morris ◽  
G.R.G Clover ◽  
V.A Harju ◽  
S.A Hugo ◽  
C.M Henry
Keyword(s):  
Virus Detection ◽  
Yellow Vein ◽  
Rt Pcr ◽  
Highly Sensitive ◽  
Pcr Method

scholarly journals Molecular Study on The Pathogenicity of Avian Influenza Virus

2015 ◽  
Vol 11 (2) ◽  
Author(s):  
Haryadi M. Wibowo ◽  
Heru Susetya ◽  
Tri Untari ◽  
Khrisdiana Putri ◽  
Charles Rangga Tabbu
Keyword(s):  
Influenza Virus ◽  
Avian Influenza ◽  
Avian Influenza Virus ◽  
Cleavage Site ◽  
Highly Pathogenic Avian Influenza ◽  
Basic Amino Acid ◽  
Molecular Study ◽  
Highly Pathogenic ◽  
Pathogenic Avian Influenza ◽  
Pathogenic Avian Influenza Virus

Highly pathogenic avian influenza virus (HPAI) differ from Low pathogenic avian influenza virus (LPAI) basedon multiple basic amino acid motif of the carboxylterminus of HA1, especially arginine and lysine. The propose ofthis work was toamplify and sequence the cleavage site region of HA gene of avian influenza virusisolated from bothcases with characteristic or unspecific lesion, using reversetranscriptase polymerase chain reaction (RT-PCR). Primerdesaigned for amplification and sequence was H5-F: 5’ ggagactcagcaatcccatgaaaag 3’ and H5-R:5’ccataccaaccgtctaccattcc 3’, and expected product size was 246 bp. The result indicated that all avian influenzavirus (AIV)-isolates originated from chicken with both specific and non specific lesion show a multiple basic aminoacid motif -PQRERRRKKR//GLF- and classified as highly pathogenic avian influenza. Philogenetic study of HAgenefragment indicated that each type of characteristic lesion created philo-groups.Key words: avian influenza, lesion, hemagglutinin, cleavage site, phylogeny.

Sign in / Sign up

Export Citation Format

Share Document