Rapid, specific and quantitative polymerase chain reaction (PCR) detection of pathogenic protozoa Entamoeba histolytica for drinking water supply

2011 ◽  
Vol 11 (4) ◽  
pp. 418-425 ◽  
Author(s):  
S. W. Lam ◽  
H. B. Zhang ◽  
L. Yu ◽  
C. H. Woo ◽  
K. N. Tiew ◽  
...  

In this study, a quantitative species-specific polymerase chain reaction (PCR) method to rapidly detect E. histolytica in water is developed. First, the specificity of E. histolytica PCR detection was verified by using species-specific primers of 16S-like rRNA genes to clearly differentiate it from the closely related amoebae species E. dispar and E. moshkovskii. The sensitivity of this method was subsequently determined using purified E. histolytica genomic DNA and culture cells as PCR reaction templates. Results indicated that conventional PCR visualized on 1% agarose gel was able to detect as low as 0.02 pg genomic DNA and 5 cells, while real-time PCR could detect 0.01 pg genomic DNA and 2 cells of E. histolytica. The protocols for E. histolytica PCR detection in real water samples were then optimized by spiking E. histolytica cells into tap water and reservoir raw water samples. A two-round centrifugation treatment to concentrate amoeba cells directly as a PCR template was the most effective way to detect E. histolytica in spiked tap water samples, while DNA extraction after concentrating amoeba cells was required for spiked reservoir raw water samples. The detection limit of 50 E. histolytica cells in 100 ml tap water was achieved in 2 h from sample collection to real-time PCR data readout. With these established protocols, 78 tap water samples, 11 reservoir raw water samples and 4 feed water samples from Singapore water supply systems were analyzed by both conventional PCR and real-time PCR methods. No E. histolytica cell was detected in tested samples.

2021 ◽  
Vol 156 (Supplement_1) ◽  
pp. S140-S140
Author(s):  
A Kalam

Abstract Introduction/Objective Diarrhea is a major source of morbidity and mortality in low-income and middle-income countries. In underdeveloped countries, diseases caused by viruses identified in environmental samples cause major health problems. Little knowledge about the frequency and pattern of viral contamination of drinking water sources in these resource-poor settings. Adenovirus which causes watery diarrhea, particular has been recognized as important causal pathogen. Adenovirus remains a global threat to public health and an indicator of inequity and lack of social development. Tap water samples from coastal sites in Karachi between 2019 and 2020 over a period of 11 months. The total of 40 tap water sample was examined for infectious Adenovirus by a real time polymerase chain reaction (PCR) amplification. Methods/Case Report This Pilot study is conducted on tap water samples from Karachi Pakistan, n=40 are processed. Extraction of nucleic acid from all filtered water samples collected with Sterivex filter units by using Qiagen DNeasy Power Water Sterivex Kit. As per the manufacturer’s instruction. Phocine herpesvirus(PhHV) is added as an external positive control to monitor the efficiency of nucleic acid extraction and amplification. TaqMan Universal PCR Master Mix (Thermo Fisher Scientific) is being used in probe based real time PCR assay,the below 35 Ct value is considered as a positive sample. Results (if a Case Study enter NA) Results showed the total of 37.7% of the sources were positive for adenovirus.The level of viral contamination was moderate to high. Conclusion The results has been showed that no seasonal pattern for viral contaminations was found after samples obtained during the dry and wet seasons were compared. Further the Real time PCR assay increases the sensitivity and provides the high resolution of pathogen detection.


2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.


2004 ◽  
Vol 70 (1) ◽  
pp. 167-173 ◽  
Author(s):  
Takahiro Matsuki ◽  
Koichi Watanabe ◽  
Junji Fujimoto ◽  
Yukiko Kado ◽  
Toshihiko Takada ◽  
...  

ABSTRACT A highly sensitive quantitative PCR detection method has been developed and applied to the distribution analysis of human intestinal bifidobacteria by combining real-time PCR with Bifidobacterium genus- and species-specific primers. Real-time PCR detection of serially diluted DNA extracted from cultured bifidobacteria was linear for cell counts ranging from 106 to 10 cells per PCR assay. It was also found that the method was applicable to the detection of Bifidobacterium in feces when it was present at concentrations of >106 cells per g of feces. Concerning the distribution of Bifidobacterium species in intestinal flora, the Bifidobacterium adolescentis group, the Bifidobacterium catenulatum group, and Bifidobacterium longum were found to be the three predominant species by examination of DNA extracted from the feces of 46 healthy adults. We also examined changes in the population and composition of Bifidobacterium species in human intestinal flora of six healthy adults over an 8-month period. The results showed that the composition of bifidobacterial flora was basically stable throughout the test period.


2014 ◽  
Vol 35 (6) ◽  
pp. 667-673 ◽  
Author(s):  
Hoonmo L. Koo ◽  
John N. Van ◽  
Meina Zhao ◽  
Xunyan Ye ◽  
Paula A. Revell ◽  
...  

Objective.To evaluate the accuracy of real-time polymerase chain reaction (PCR) for Clostridium difficile–associated disease (CDAD) detection, after hospital CDAD rates significantly increased following real-time PCR initiation for CDAD diagnosis.Design.Hospital-wide surveillance study following examination of CDAD incidence density rates by interrupted time series design.Setting.Large university-based hospital.Participants.Hospitalized adult patients.Methods.CDAD rates were compared before and after real-time PCR implementation in a university hospital and in the absence of physician and infection control practice changes. After real-time PCR introduction, all hospitalized adult patients were screened for C. difficile by testing a fecal specimen by real-time PCR, toxin enzyme-linked immunosorbent assay, and toxigenic culture.Results.CDAD hospital rates significantly increased after changing from cell culture cytotoxicity assay to a real-time PCR assay. One hundred ninety-nine hospitalized subjects were enrolled, and 101 fecal specimens were collected. C. difficile was detected in 18 subjects (18%), including 5 subjects (28%) with either definite or probable CDAD and 13 patients (72%) with asymptomatic C. difficile colonization.Conclusions.The majority of healthcare-associated diarrhea is not attributable to CDAD, and the prevalence of asymptomatic C. difficile colonization exceeds CDAD rates in healthcare facilities. PCR detection of asymptomatic C. difficile colonization among patients with non-CDAD diarrhea may be contributing to rising CDAD rates and a significant number of CDAD false positives. PCR may be useful for CDAD screening, but further study is needed to guide interpretation of PCR detection of C. difficile and the value of confirmatory tests. A gold standard CDAD diagnostic assay is needed.Infect Control Hosp Epidemiol 2014;35(6):667–673


2014 ◽  
Vol 70 (3) ◽  
pp. 555-560 ◽  
Author(s):  
Naohiro Kishida ◽  
Naohiro Noda ◽  
Eiji Haramoto ◽  
Mamoru Kawaharasaki ◽  
Michihiro Akiba ◽  
...  

We describe an assay for simple and accurate quantification of human enteric adenoviruses (EAdVs) in water samples using a recently developed quantification method named microfluidic digital polymerase chain reaction (dPCR). The assay is based on automatic distribution of reaction mixture into a large number of nanolitre-volume reaction chambers and absolute copy number quantification from the number of chambers containing amplification products on the basis of Poisson statistics. This assay allows absolute quantification of target genes without the use of standard DNA. Concentrations of EAdVs in Japanese river water samples were successfully quantified by the developed dPCR assay. The EAdVs were detected in seven of the 10 samples (1 L each), and the concentration ranged from 420 to 2,700 copies/L. The quantified values closely resemble those by most probable number (MPN)-PCR and real-time PCR when standard DNA was validated by dPCR whereas they varied substantially when the standard was not validated. Accuracy and sensitivity of the dPCR was higher than those of real-time PCR and MPN-PCR. To our knowledge, this is the first study that has successfully quantified enteric viruses in river water using dPCR. This method will contribute to better understanding of existence of viruses in water.


Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 298-303 ◽  
Author(s):  
Suren K. Samuelian ◽  
Lindsay A. Greer ◽  
Sandra Savocchia ◽  
Christopher C. Steel

Bitter rot (Greeneria uvicola) and ripe rot (Colletotrichum acutatum, syn. C. simmondsii) occur frequently in subtropical grape-growing regions of Australia, where they cause yield loss and bitter taints in wine. To further advance the epidemiological studies of G. uvicola and C. acutatum and contribute toward their effective management and control, a rapid and reliable species-specific real-time polymerase chain reaction (PCR) method was developed based on the polymorphic portion of the internal transcribed spacer region of the two fungi. It was found that, within 6 to 8 h postinoculation, the assay could detect as little as 20 fg of genomic DNA and 10 conidia for both species. Artificially and naturally infected grape inflorescences and mature berries were analyzed by both conventional plating methods and real-time PCR. Fungal presence was demonstrated on all plant material but development was observed only on mature berries. The results demonstrate that the real-time PCR technique is a highly specific, rapid, and sensitive method that can be used to detect and study the dynamics of G. uvicola and C. acutatum during different stages of infection and on different grape tissues.


Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 430-434 ◽  
Author(s):  
M. P. Grisham ◽  
Y.-B. Pan ◽  
E. P. Richard

A real-time, polymerase chain reaction (PCR) assay was developed for detecting Leifsonia xyli subsp. xyli in sugarcane leaf tissue. Real-time PCR assays were conducted on the youngest, fully expanded leaf of three cultivars collected bi-weekly from field nurseries between 11 April and 19 July 2005. L. xyli subsp. xyli infection was detected in leaves collected at all sampling dates, including those from 1-month-old plants on 11 April. Assays conducted on older, more rapidly growing plants (28 July and 21 October 2005) indicated that leaf position affects assay efficiency. Conventional PCR was less efficient than real-time PCR for detecting L. xyli subsp. xyli in leaf tissue. Real-time PCR was used to rank cultivars for susceptibility to L. xyli subsp. xyli infection based on the relative titer of L. xyli subsp. xyli in leaves of inoculated, 3- and 4-month-old greenhouse-grown plants. The ranking of cultivars by real-time PCR was in close agreement with the ranking determined by tissue-blot enzyme immunoassay performed on tissue from 7- to 9-month-old stalks.


Sign in / Sign up

Export Citation Format

Share Document