scholarly journals Influence of climate changes in the Czech Republic on the distribution of plant viruses and phytoplasmas originally from the mediterranean subtropical region

2010 ◽  
Vol 45 (Special Issue) ◽  
pp. S20-S26 ◽  
Author(s):  
J. Polák
Keyword(s):  
Czech Republic ◽  
Climate Changes ◽  
Plant Pathogens ◽  
Zucchini Yellow Mosaic Virus ◽  
Plant Viruses ◽  
Northern Italy ◽  
Yellow Mosaic Virus ◽  
Plum Pox Virus ◽  
The Czech Republic ◽  
Peach Trees

Results of research aiming at monitoring of climate changes impact on plant pathogens distribution such as <i>Zucchini yellow mosaic virus</i> (ZYMV), quarantine <i>Plum pox virus</i> (PPV) and quarantine phytoplasma European stone fruit yellows (ESFY) are presented here. ZYMV has spread from Northern Italy across Austria up to Central Moravia and Bohemia. PPV has been continuously spreading from the lowlands of Central Bohemia and Moravia up to plains. Later, from the sixties and seventies of the last century, due to climate warming and human activities the virus quickly spread to uplands, foothills and mountains of the Czech Republic. Phytoplasma ESFY was spreading in a manner similar to ZYMV in the eighties of the twentieth century from Northern Italy and currently is affecting mainly apricot and peach trees in Southern Moravia.

scholarly journals Distribution, variabiality and overwintering of Zucchini yellow mosaic virus in the Czech Republic

2012 ◽  
Vol 38 (No. 4) ◽  
pp. 125-130 ◽  
Author(s):  
J. Svoboda ◽  
J. Polák
Keyword(s):  
Czech Republic ◽  
Mosaic Virus ◽  
Cucurbita Pepo ◽  
Zucchini Yellow Mosaic Virus ◽  
Yellow Mosaic Virus ◽  
Weed Species ◽  
Stellaria Media ◽  
The Czech Republic ◽  
Indicator Plants ◽  
Severe Stunting

The incidence of Zucchini yellow mosaic virus (ZYMV) was monitored in the south Moravian region of the Czech Republic during 1997&ndash;2001. Crops of gherkin, squash, zucchini and cucumbers were found infected with ZYMV, manifested by symptoms of severe stunting and yellowing with deformed leaves and fruits. Twenty to eighty percent of infected plants were recorded. Six isolates of ZYMV from four localities were differentiated on indicator plants; three of them were maintained as being typical for differences in pathogenicity. Overwintered weed species were tested for the presence of the virus. ZYMV was detected by ELISA in one plant of Tripleurospermum maritimum out of 46 tested, and in two plants of Stellaria media out of 29 tested in 2001. Such tests were repeated in 2002, and ZYMV was detected in three plants of T. maritimum out of 45 tested, in three plants of S. media out of 52, and in two plants of Trifolium repens out of 17 tested. The virus was successfully transmitted from T. maritimum, S. media and T. repens to indicator plants of Cucurbita pepo convar. giromontiina. Back-transmission of ZYMV was proved by ELISA, electron microscopy and symptoms. T. maritimum was found to be a new natural host of ZYMV.

scholarly journals A Polish Isolate of Zucchini yellow mosaic virus from Zucchini is Distinct from Other European Isolates

Plant Disease ◽  
2007 ◽  
Vol 91 (5) ◽  
pp. 639-639 ◽  
Author(s):  
H. Pospieszny ◽  
B. Hasiów ◽  
N. Borodynko
Keyword(s):  
Amino Acid ◽  
Mosaic Virus ◽  
Citrullus Lanatus ◽  
Zucchini Yellow Mosaic Virus ◽  
Amino Acid Identity ◽  
Plant Viruses ◽  
Yellow Mosaic Virus ◽  
Parameter Method ◽  
Acid Identity ◽  
Conserved Sequence

Zucchini yellow mosaic virus (ZYMV) is a member of the Potyvirus genus in the Potyviridae family, the largest group of plant viruses. Different isolates of this virus have been found in infected cucurbits throughout the world, including localities in Europe, America, Australia, and Asia. In August 2005, mosaic and yellowing of leaves, as well as yellow spots on green fruits, were observed on zucchini (Cucurbita pepo cv. giromontiina) growing in commercial fields in the Kujawsko-Pomorskie Region of Poland. Flexuous virus particles (~750 nm long), typical of potyviruses, were observed in leaf-dip preparations from symptomatic zucchini plants. The virus in the sap from symptomatic plants was mechanically transmitted and systemic infections were produced on Citrullus lanatus, Cucumis melo, Cucumis sativus, C. pepo cvs. giromontiina and patissoniana, C. maxima, and Nicotiana benthamiana. Severe symptoms such as severe malformation of leaves and stunting of plants were observed on zucchini plants (cv. giromontiina) infected mechanically with the virus and grown in the greenhouse. Double-antibody sandwich (DAS)-ELISA using an anti-ZYMV polyclonal antiserum (AS-0234; DSMZ, Braunschweig, Germany) identified the presence of ZYMV in mechanically infected C. pepo cv. giromontiina and N. benthamiana plants. Subsequently, a reverse transcription (RT)-PCR using a universal primer, Sprimer, designed from the consensus sequences that code for the conserved sequence GNNSGQP in the NIb region of Potyviridae family members and the M4 primer was performed (1). The 1740-bp PCR fragments were cloned into the pGEM-T vector (Promega, Madison, WI) and three randomly selected clones were sequenced on an ABI automatic sequencer. An 837-bp sequence representing the full length coat protein gene (GenBank Accession No. EF178505) was compared with homologous sequences from other ZYMV isolates using BioEdit and Mega 3.1 softwares. Genetic distances were calculated by Kimura's two-parameter method (2). Surprisingly, the Polish ZYMV isolate (ZYMV-Zug) was more closely related to ZYMV isolates from Asia than those from Europe. Pairwise comparisons of ZYMV-Zug with several other European ZYMV isolates (GenBank Accession Nos. DQ645729, AJ420020, AJ459956, AJ420014, AJ420019, DQ124239, and AJ420018) indicated an 81 to 82% nucleotide and 91 to 92% amino acid identity, while there was a 94% nucleotide and 99% amino acid identity with the Shanxi (GenBank Accession No. AY074808) and Shandong isolates (GenBank Accession No. AF513552) from China. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) S. Kumar et al. Brie. Bioinform. 5:150, 2004.

scholarly journals The Impact of Innovation and Information Technology on Greenhouse Gas Emissions: A Case of the Visegrád Countries

2021 ◽  
Vol 14 (2) ◽  
pp. 59
Author(s):  
Radosław Miśkiewicz
Keyword(s):  
Information Technology ◽  
Czech Republic ◽  
Greenhouse Gas Emissions ◽  
Greenhouse Gas ◽  
Climate Changes ◽  
Slovak Republic ◽  
Ghg Emissions ◽  
Control Variables ◽  
The Czech Republic ◽  
Visegrád Countries

The rapid growth of negative consequences from climate changes provokes divergent effects in all economic sectors. The experts proved that a core catalyst which bootstrapped the climate changes was greenhouse gas emission. This has led to a range of social, economic, and ecological issues. Such issues could be solved by extending innovation and information technology. This paper aimed to check the hypothesis that innovation and information technology allowed for a reduction of greenhouse gas emissions. The author used such methodology as OLS, fully modified OLS (FMOLS), dynamic OLS (DMOLS), Dicky-Fuller and Phillips-Perron tests. The research is informed by the report of the World Economic Forum, World Data Bank, Eurostat for the Visegrád countries (Hungary, Poland, Check Republic, Slovakia) for the period of 2000–2019. The findings were confirmed in models without control variables, and an increase of 1% of patents led to reducing greenhouse gas (GHG) emissions by 0.28% for Poland, 0.28% for Hungary, 0.38% for the Slovak Republic and 0.46% for the Czech Republic. At the same time, for the models with control variables, only Hungary experienced a statistically significant impact. There, an increase of patents by 1% led to reduction of GHG emissions by 0.22%. The variable R&D expenditure was statistically significant for all countries and all types of models (with and without control variables). The increase of R&D expenditure provoked a decline of GHG emissions by 0.29% (without control variables) and 0.11% (with control variables) for Poland, by 0.26% (without control variables) and 0.41% (with control variables) for Hungary, by 0.3% (without control variables) and 0.23% (with control variables) for the Slovak Republic and by 0.54% (without control variables) and 0.38% (with control variables) for the Czech Republic.

scholarly journals Modifications of the Helper Component-Protease of Zucchini yellow mosaic virus for Generation of Attenuated Mutants for Cross Protection Against Severe Infection

2007 ◽  
Vol 97 (3) ◽  
pp. 287-296 ◽  
Author(s):  
Shih-Shun Lin ◽  
Hui-Wen Wu ◽  
Fuh-Jyh Jan ◽  
Roger F. Hou ◽  
Shyi-Dong Yeh
Keyword(s):  
Mosaic Virus ◽  
Fluorescent Protein ◽  
Zucchini Yellow Mosaic Virus ◽  
Chenopodium Quinoa ◽  
Severe Infection ◽  
Plant Viruses ◽  
Cross Protection ◽  
Yellow Mosaic Virus ◽  
Mild Strain ◽  
Helper Component

A nonpathogenic mild strain is essential for control of plant viruses by cross protection. Three amino acid changes, Arg180→Ile180 (GA mutation), Phe205→Leu205 (GB mutation), and Glu396→Asn396 (GC mutation), of the conserved motifs of the helper component-protease (HC-Pro) of a severe strain TW-TN3 of Zucchini yellow mosaic virus (ZYMV), a member of the genus Potyvirus, were generated from an infectious cDNA clone that carried a green fluorescent protein reporter. The infectivity of individual mutants containing single, double, or triple mutations was assayed on local and systemic hosts. On Chenopodium quinoa plants, the GB mutant induced necrotic lesions; the GA, GC, and GBC mutants induced chlorotic spots; and the GAB and GAC mutants induced local infection only visualized by fluorescence microscopy. On squash plants, the GA, GB, GC, and GBC mutants caused milder mosaic; the GAC mutant induced slight leaf mottling followed by recovering; and the GAB mutant did not induce conspicuous symptoms. Also, the GAC mutant, but not the GAB mutant, conferred complete cross protection against the parental virus carrying a mite allergen as a reporter. When tested on transgene-silenced transgenic squash, the ability of posttranscriptional gene silencing suppression of the mutated HC-Pro of GAC was not significantly affected. We concluded that the mutations of the HC-Pro of ZYMV reduce the degrees of pathogenicity on squash and also abolish the ability for eliciting the hypersensitive reaction on C. quinoa, and that the mutant GAC is a useful mild strain for cross protection.

scholarly journals First Report of Trichodorus similis from the Czech Republic (Nematoda: Trichodoridae)

Plant Disease ◽  
2007 ◽  
Vol 91 (2) ◽  
pp. 228-228 ◽  
Author(s):  
S. Kumari ◽  
J. Vohanka ◽  
W. Decraemer
Keyword(s):  
Czech Republic ◽  
Plant Pathogens ◽  
Deciduous Forest ◽  
Large Subunit ◽  
Single Male ◽  
Male Specimen ◽  
The Czech Republic ◽  
First Report ◽  
Damage Level ◽  
Plant Pathol

Members of the Trichodoridae can cause substantial crop losses directly by feeding on plant roots and indirectly as vectors of tobraviruses; both vector and virus are polyphagous. Although trichodorid nematodes are important pests of agricultural crops, no data are available on the presence or extent of these nematodes in the Czech Republic. In June 2005, three soil samples from the rhizosphere of a Quercus sp. at Cerveny Vrch yielded a population of Trichodorus similis Seinhorst, 1963. Specimens were extracted from soil by a decanting-sieving method, heat killed, and fixed in triethanolamine formalin (TAF), and processed and mounted in anhydrous glycerin. Nematodes were identified by morphological and morphometrical characters (2). Classical identification of these nematodes was further verified by molecular study. A single, male specimen was temporarily mounted in distilled water on a glass slide and relaxed with gentle heat. Measurements and photographs were taken, and the specimen was transferred to a 0.5-ml Eppendorf tube containing 0.25 M NaOH. Total genomic DNA was prepared by a rapid technique (4). Morphometric data of the male specimen used for DNA study are: body length 867 μm; body width 81 μm; onchiostyle length 44 μm; spicule length 36 μm; distance of anterior cervical papilla (CP)1 from anterior end 39 μm, CP1 to CP2 25 μm, CP2 to CP3 22 μm; posterior precloacal supplement (SP1) to cloacal opening 27 μm, distance SP1 to SP2 32 μm, distance SP2 to SP3 39 μm. The following primers were used in the PCR reaction: species-specific sense primer SIMIREV2 (5′-CACTCGTCGGACTCAAACC-3′) and universal antisense primer UNIVERSAL (5′-CCCGTCGCTACTACCGATT-3′) (1). A single fragment of approximately 452 bp was amplified. The D2 and D3 expansion regions of the large subunit 28S rDNA were amplified using the primer D2A (5′-ACAAGTACCGTGAGGGAAAGTTG-3′) and D3B (5′-TCGGAAGGAACCAGCTACTA-3′ (3). The region was sequenced after purification of PCR products from the gel slice with a Qiagen gel purification kit (Qiagen Inc., Valencia, CA). The obtained sequence was deposited in Genbank (Accession No. DQ832183). The obtained sequence was compared by BLAST in NCBI and the results showed strong similarities with T. similis (Accession No. AM180730). To our knowledge, this is the first report of T. similis associated with a deciduous forest in the Czech Republic. Taking into account the agricultural importance of trichodorids and tobraviruses as plant pathogens, there is a need for a comprehensive survey of these taxa in the Czech Republic. The damage level threshold is in the case of virus vector species equivalent to a single nematode. Therefore, information on these plant parasites would be useful for developing nematode management strategies. References: (1) K. Boutsika et al. Plant Pathol. 53:110, 2004. (2) W. Decraemer and P. Baujard. Fundam. Appl. Nematol. 21:37, 1998. (3) P. De Ley et al. Nematology 2:591, 1999. (4) J. M. Stanton. Australas. Plant Pathol. 27:112, 1998.

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

scholarly journals Survey of virus pathogens in gladiolus, iris and tulips in the Czech Republic

2009 ◽  
Vol 57 (5) ◽  
pp. 79-86 ◽  
Author(s):  
Ganesh Selvaraj Duraisamy ◽  
Radovan Pokorný
Keyword(s):  
Czech Republic ◽  
Cucumber Mosaic Virus ◽  
Mosaic Virus ◽  
Ornamental Plants ◽  
Tobacco Rattle Virus ◽  
Yellow Spot ◽  
Yellow Mosaic Virus ◽  
Spot Virus ◽  
The Czech Republic ◽  
Aerial Parts

The occurrence of Bean yellow mosaic virus (BYMV), Cucumber mosaic virus (CMV) Tobacco rattle virus (TRV) in gladiolus, iris, tulip and Iris yellow spot virus (IYSV) in iris was investigated by examining the plants by the means of serological techniques (ELISA). ELISA was applied to determine the presence of BYMV, CMV, TRV infections in both aerial and underground parts of gladiolus, iris, and tulip, and IYSV on the aerial parts of iris, respectively. 262 gladiolus plants were tested. 63.7% was infected by BYMV, 29.4 % by CMV, and 2.7 % by TRV. Out of 180 plants of iris, 1.1% was infected by BYMV, 6.7% by CMV, 2.8% by TRV, and 0% by IYSV. Out of 28 plants of tulip, 28.6% was infected by CMV, and 7.1% by TRV. ELISA proved to be a suitable method for detection of viruses in leaves of these ornamental plants, but it often failed to detect viruses in flowers and corms. A high transmission of BYMV by gladiolus cormlets was also found.

scholarly journals First Report of Cucurbit aphid-borne yellows virus in Squash in the Czech Republic

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 220-220 ◽  
Author(s):  
J. Svoboda ◽  
L. Leisova-Svobodova ◽  
H. Lecoq
Keyword(s):  
Czech Republic ◽  
Cucurbita Pepo ◽  
Sandwich Elisa ◽  
Yellow Mosaic Virus ◽  
Research Report ◽  
Natural Occurrence ◽  
The Czech Republic ◽  
First Report ◽  
Sequence Identity ◽  
Three Samples

A yellowing of buttercup squash (Cucurbita pepo L. var. oleifera Pietsch) leaves was observed on plants in southern Moravia, the main squash-growing area of the Czech Republic. Forty leaf samples were collected in September 2009 and examined for the presence of possible cucurbit viruses by double-antibody sandwich-ELISA. Thirty-three samples were infected with Zucchini yellow mosaic virus and five with Cucurbit aphid-borne yellows virus (CABYV). The positive samples of CABYV originated near the villages of Josefov and Prušánky (one per sample) and Rakvice (three samples), and the virus isolates were named Jos-5, Pr-15, Rak-1, Rak-4, and Rak-5, respectively. CABYV was immediately transmitted from leaves collected in the field to summer squash (Cucurbita pepo L. convar. giromontiina Grebenšcikov) plants by aphids in a persistent manner. Green peach aphids, Myzus persicae (Sulzer), were used to inoculate squash plants with acquisition and inoculation feeding times of 2 and 5 days, respectively. Twenty-one plants were inoculated with 20 aphids per plant. Transmission was successful in 25% of the plants as assessed by ELISA. Infected plants showed very mild yellowing 2 weeks after transmission and were shorter compared with noninoculated controls. Leaf samples of newly infected plants were examined by electron microscopy and isometric particles of approximately 25 nm in diameter, corresponding in size and shape to described particles of CABYV (3), were observed. The presence of CABYV was verified by reverse transcription (RT)-PCR using a primer pair specific to the CABYV coat protein gene (2). The amplicons were sequenced (GenBank Accession Nos. HM771269–HM771273) and 100% sequence identity was found between isolates Jos-5 and Pr-15 and among the isolates Rak-1, Rak-2, and Rak-3. Sequence identity between these two groups was 99.3%. Blast analysis (4) showed that the Czech CABYV isolates are closely related to the Slovak isolates SK-1 (Accession No. FJ428797) and IR-3 (Accession No. FJ428800) with nucleotide sequence identities of 99.6 and 99.1%, respectively. These results indicate a similar origin between the Czech and Slovak isolates. To our knowledge, this is the first report of the natural occurrence of CABYV in the Czech Republic. CABYV is a widespread virus that reduces the yield of cucurbit vegetables (1). Protection against epidemics should be based on the control of aphid vectors, protecting plants with very fine mesh netting, keeping the cultivation area free of weeds, or planting cultivars resistant to CABYV. References: (1) Anonymous. Research Report 1995-1996, 117. Vegetable Breeding Station, INRA, Montfavet, France, 1998. (2) M. Juarez at al., Plant Dis. 88:907, 2004. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992. (4) Z. Zhang Z. et al. J. Comput. Biol. 7:203, 2000.

Sign in / Sign up

Export Citation Format

Share Document