scholarly journals Marcadores moleculares

2017 ◽  
pp. 73
Author(s):  
June Simpson
Keyword(s):  
Molecular Markers ◽  
Molecular Biology ◽  
Molecular Marker ◽  
Diversity Analysis ◽  
Marker System ◽  
Individual Laboratory ◽  
Dominant Markers ◽  
Laboratory Facilities

Molecular markers are becoming essential tools in many areas of biology including bio-medicine, breeding, forensics and diversity analysis. In addition they are also being exploited to locate and isolate genes of interest. A variety of DNA based molecular marker techniques are now available. Individual techniques employ different methods used routinely in molecular biology and different kinds of markers are distinguished by their capacity to detect polymorphism at one or many loci and whether they are dominant or co-dominant markers. The choice of marker system will depend on individual laboratory facilities and the applications of interest to each researcher.

Molecular markers and antioxidant activity in berry crops: Genetic diversity analysis

2012 ◽  
Vol 92 (6) ◽  
pp. 1121-1133 ◽  
Author(s):  
S. C. Debnath ◽  
Y. L. Siow ◽  
J. Petkau ◽  
D. An ◽  
N. V. Bykova
Keyword(s):  
Genetic Diversity ◽  
Antioxidant Activity ◽  
Molecular Markers ◽  
Molecular Techniques ◽  
Diversity Analysis ◽  
Full Potential ◽  
Genetic Diversity Analysis ◽  
Wide Range ◽  
Berry Crops ◽  
Improvement Programs

Debnath, S. C., Siow, Y. L., Petkau, J., An, D. and Bykova, N. V. 2012. Molecular markers and antioxidant activity in berry crops: Genetic diversity analysis. Can. J. Plant Sci. 92: 1121–1133. An improved understanding of important roles of dietary fruits in maintaining human health has led to a dramatic increase of global berry crop production. Berry fruits contain relatively high levels of vitamin C, cellulose and pectin, and produce anthocyanins, which have important therapeutic values, including antitumor, antiulcer, antioxidant and anti-inflammatory activities. There is a need to develop reliable methods to identify berry germplasm and assess genetic diversity/relatedness for dietary properties in berry genotypes for practical breeding purposes through genotype selection in a breeding program for cultivar development, and proprietary-rights protection. The introduction of molecular biology techniques, such as DNA-based markers, allows direct comparison of different genetic materials independent of environmental influences. Significant progress has been made in diversity analysis of wild cranberry, lowbush blueberry, lingonberry and cloudberry germplasm, and in strawberry and raspberry cultivars and advanced breeding lines developed in Canada. Inter simple sequence repeat (ISSR) markers detected an adequate degree of polymorphism to differentiate among berry genotypes, making this technology valuable for cultivar identification and for the more efficient choice of parents in the current berry improvement programs. Although multiple factors affect antioxidant activity, a wide range of genetic diversity has been reported in wild and cultivated berry crops. Diversity analysis based on molecular markers did not agree with those from antioxidant activity. The paper also discusses the issues that still need to be addressed to utilize the full potential of molecular techniques including expressed sequence tag-polymerase chain reaction (EST-PCR) analysis to develop improved environment-friendly berry cultivars suited to the changing needs of growers and consumers.

Characterization of High-Copy-Number Retrotransposons From the Large Genomes of the Louisiana Iris Species and Their Use as Molecular Markers

Genetics ◽  
2003 ◽  
Vol 164 (2) ◽  
pp. 685-697 ◽  
Author(s):  
Edward K Kentner ◽  
Michael L Arnold ◽  
Susan R Wessler
Keyword(s):  
Molecular Markers ◽  
Copy Number ◽  
High Copy Number ◽  
Marker System ◽  
Transposon Display ◽  
Plant Genomes ◽  
Large Plant ◽  
Backcross Hybrids ◽  
Abundance And Distribution

Abstract The Louisiana iris species Iris brevicaulis and I. fulva are morphologically and karyotypically distinct yet frequently hybridize in nature. A group of high-copy-number TY3/gypsy-like retrotransposons was characterized from these species and used to develop molecular markers that take advantage of the abundance and distribution of these elements in the large iris genome. The copy number of these IRRE elements (for iris retroelement), is ∼1 × 105, accounting for ∼6–10% of the ∼10,000-Mb haploid Louisiana iris genome. IRRE elements are transcriptionally active in I. brevicaulis and I. fulva and their F1 and backcross hybrids. The LTRs of the elements are more variable than the coding domains and can be used to define several distinct IRRE subfamilies. Transposon display or S-SAP markers specific to two of these subfamilies have been developed and are highly polymorphic among wild-collected individuals of each species. As IRRE elements are present in each of 11 iris species tested, the marker system has the potential to provide valuable comparative data on the dynamics of retrotransposition in large plant genomes.

scholarly journals Diversity analysis of green gram (Vigna radiata (L.) Wilczek)through morphological and molecular markers

2016 ◽  
Vol 40 ◽  
pp. 229-240 ◽  
Author(s):  
Gunjeet KAUR ◽  
Anurabh JOSHI ◽  
Devendra JAIN ◽  
Ravish CHOUDHARY ◽  
Divya VYAS
Keyword(s):  
Molecular Markers ◽  
Vigna Radiata ◽  
Green Gram ◽  
Diversity Analysis

scholarly journals The Importance of Identification of M-BCRABL Oncogene and JAK2V617F Mutation in Myeloproliferative Neoplasms

2014 ◽  
Vol 60 (2) ◽  
pp. 44-48
Author(s):  
Annamária Szántó ◽  
Zsuzsanna Pap ◽  
Z Pávai ◽  
I Benedek ◽  
Judit Beáta Köpeczi ◽  
...  
Keyword(s):  
Molecular Markers ◽  
Molecular Biology ◽  
Myeloproliferative Neoplasms ◽  
Philadelphia Chromosome ◽  
Gene Mutations ◽  
Chronic Phase ◽  
Final Diagnosis ◽  
Jak2v617f Mutation ◽  
Myeloproliferative Disease

Abstract Background: The elucidation of the genetic background of the myeloproliferative neoplasms completely changed the management of these disorders: the presence of the Philadelphia chromosome and/or the BCR-ABL oncogene is pathognomonic for chronic myeloid leukemia and identification of JAK2 gene mutations are useful in polycytemia vera (PV), essential thrombocytemia (ET) and myelofibrosis (PMF). The aim of this study was to investigate the role of molecular biology tests in the management of myeloproliferative neoplasms. Materials and methods: We tested the blood samples of 117 patients between April 2008 and February 2013 at the Molecular Biology of UMF Târgu Mureș using RQ-PCR (for M-BCR-ABL oncogene) and/or allele-specific PCR (for JAK2V617F mutation). Results: Thirty-two patients presented the M-BCR-ABL oncogene, 16 of them were regularly tested as a follow-up of the administered therapy: the majority of chronic phase patients presented decreasing or stable values, while in case of accelerated phase and blast phase the M-BCR-ABL values increased or remained at the same level. Twenty patients were identified with the JAK2V617F mutation: 8 patients with PV, 4 with ET, 3 with PMF, 4 with unclassifiable chronic myeloproliferative disease and 1 patient with chronic myelomonocytic leukemia. There was no case of concomitant occurance of both molecular markers. Conclusions: Molecular biology testing plays an important role in the management of myeloproliferative neoplasms: identification of the molecular markers confirms the final diagnosis, excluding secondary causes of abnormal blood count parameters. Regular monitoring of MBCR- ABL expression level is useful in the follow-up of therapeutic efficiency.

scholarly journals Genetic Diversity Analysis of Indonesian Pigmented Rice Accessions Based on Functional Molecular Markers

2021 ◽  
Vol 17 (1) ◽  
pp. 25
Author(s):  
Andari Risliawati ◽  
Yusi N. Andarini ◽  
Rerenstradika T. Terryana ◽  
Kristianto Nugroho ◽  
Puji Lestari
Keyword(s):  
Genetic Diversity ◽  
Molecular Markers ◽  
Gene Bank ◽  
Diversity Analysis ◽  
Anthocyanin Content ◽  
Local Varieties ◽  
Pigmented Rice ◽  
Health Studies ◽  
Pericarp Color ◽  
Functional Molecular Markers

Pigmented rice is functional staple food that becomes popular because of its anthocyanin content which is beneficial for health. Studies on the diversity of the local variety of Indonesian pigmented rice accessions have been carried out, but are still limited to one region of germplasm origin. This study aimed to analyze the genetic diversity of local varieties of pigmented rice collections of the IAARD-ICABIOGRAD Gene Bank. A total of 93 pigmented rice accessions from 16 provinces in Indonesia were analyzed using 15 functional molecular markers of SSR, STS, and indel. The total alleles detected were 115 with an average per locus of genetic diversity value of 0.71. There were five markers with PIC values >0.75, i.e. RM167, RM223, R8M33, R10M10, and GBSS1. The accessions were divided into two main groups based on their pericarp color. It is necessary to analyze the physicochemical content of the local rice accessions to complement the existing diversity information and identify potential pigmented rice accessions with high palatability.

FRAGMENT DNA 387BP GENE LECTIN OF SOYBEAN (Glycne Max L.) MERIIL

Jurnal BIOMA ◽  
2017 ◽  
Vol 13 (1) ◽  
pp. 33-36
Author(s):  
Rini Puspitaningrum ◽  
Ria Amelia ◽  
Adisyahputra Adisyahputra
Keyword(s):  
Molecular Markers ◽  
Glycine Max ◽  
Molecular Marker ◽  
Pcr Amplification ◽  
Housekeeping Gene ◽  
Descriptive Study ◽  
Gene Fragment ◽  
Lectin Gene ◽  
Glycine Max L

Lectin gene is a housekeeping gene that can be used as a molecular marker soybean (Glycine max (L.) Meriil.). This study aimed to obtain the identity of the lectin gene molecular markers for breeding purposes. This descriptive study was performed using PCR amplification and identification of sequences using a lectin gene fragment sequencing techniques and phylogenetic search using Mega Tree programme. The results obtained are lectin gene fragment along 387bp used primer Leic Foward GCGGAAACTGTTTCTTTCAGCTGG and primer Leic Reverse CCGGAAAGTGTCAAACTCAACAGCG.

Congruence between morphological and molecular markers for genetic diversity analysis applied to forage palm genotypes propagated via bioreactors

2020 ◽  
Vol 147 ◽  
pp. 112230
Author(s):  
Selma Silva Rocha ◽  
Luciana Cardoso Nogueira Londe ◽  
Samy Pimenta ◽  
Maurício Mendes Cardoso ◽  
Nívio Poubel Gonçalves ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
Molecular Markers ◽  
Diversity Analysis ◽  
Genetic Diversity Analysis
Sign in / Sign up

Export Citation Format

Share Document