scholarly journals Seasonal Dynamics of Thrips (Thrips tabaci) (Thysanoptera: Thripidae) Transmitters of Iris Yellow Spot Virus: A Serious Viral Pathogen of Onion Bulb and Seed Crops

2014 ◽  
Vol 107 (1) ◽  
pp. 75-82 ◽  
Author(s):  
Sudeep Bag ◽  
Silvia I. Rondon ◽  
Keri L. Druffel ◽  
David G. Riley ◽  
Hanu R. Pappu
Keyword(s):  
Seasonal Dynamics ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
Viral Pathogen ◽  
Seed Crops

scholarly journals First Report of Iris yellow spot virus Infecting Onion in Pakistan

Plant Disease ◽  
2013 ◽  
Vol 97 (11) ◽  
pp. 1517-1517 ◽  
Author(s):  
R. Iftikhar ◽  
S. Bag ◽  
M. Ashfaq ◽  
H. R. Pappu
Keyword(s):  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Spot Virus ◽  
Viral Pathogen ◽  
Widespread Occurrence ◽  
First Report ◽  
Allium Cepa L ◽  
Seed Crops ◽  
Agricultural Organization

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals Iris yellow spot virus in Onion Seed Crops in South Africa

Plant Disease ◽  
2007 ◽  
Vol 91 (9) ◽  
pp. 1203-1203 ◽  
Author(s):  
L. J. du Toit ◽  
J. T. Burger ◽  
A. McLeod ◽  
M. Engelbrecht ◽  
A. Viljoen
Keyword(s):  
South Africa ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Western Cape ◽  
Spot Virus ◽  
Total Rna ◽  
Onion Seed ◽  
Seed Crops ◽  
Np Gene

In December 2006, symptoms typical of iris yellow spot caused by Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) were observed on scapes (seed stalks) in an onion (Allium cepa L.) seed crop in the Klein Karoo of the Western Cape Province, South Africa. Symptoms included diamond-shaped chlorotic or necrotic lesions on the scapes, some of which had ‘green-islands’ with nested diamond-shaped lesions, as well as indistinct, circular to irregular, chlorotic or necrotic lesions of various sizes. At the time symptoms were observed, approximately 5% of the scapes had lodged as a result of extensive lesions resembling those caused by IYSV. The crop was 2 to 3 weeks from harvest. Symptomatic tissue from two plants (two samples from one plant and four samples from the other plant) was tested for IYSV by reverse-transcriptase (RT)-PCR. Total RNA was extracted from symptomatic scape tissue with the SV Total RNA Isolation System (Promega, Madison, WI) according to the manufacturer's instructions. First strand cDNA was synthesized with the RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas Inc., Hanover, MD), followed by PCR amplification with primers IYSV-For (TGG YGG AGA TGY RGA TGT GGT) and IYSV-Rev (ATT YTT GGG TTT AGA AGA CTC ACC), which amplify the nucleocapsid (NP) gene of IYSV. An amplicon of expected size (approximately 750 bp) was observed for each of the symptomatic plants assayed and was sequenced. Comparison of the sequence (GenBank Accession No. EF579801) with GenBank sequences revealed 95% sequence identity with the NP gene of IYSV GenBank Accession No. EF419888, with eight amino acid differences. The known geographic distribution of IYSV in onion bulb or seed crops has increased rapidly in recent years in many areas of the world (1). To our knowledge, this is the first confirmation of IYSV in South Africa. Approximately 6,100 ha of onion bulb crops are grown annually in South Africa in the Western Cape, Kwazulu Natal, Limpopo, and Northern Cape provinces, and 600 ha of onion seed crops are grown primarily in the semi-arid regions of the Western Cape. Examination of an additional 10 onion seed crops in the Klein Karoo during January 2007 revealed the presence of iris yellow spot in three more crops at approximately 5% incidence in each crop. The four symptomatic crops had all been planted as bulb-to-seed crops, using vernalized bulbs produced on the same farm. This suggests that IYSV may have been disseminated into the seed crops on the vernalized bulbs, either as infected bulb tissue or in viruliferous thrips on the bulbs. Reference: (1) D. H. Gent et al. Plant Dis. 90:1468, 2006.

scholarly journals First Report of Iris yellow spot virus in Onion in Mauritius

Plant Disease ◽  
2010 ◽  
Vol 94 (11) ◽  
pp. 1373-1373 ◽  
Author(s):  
K. Lobin ◽  
A. Saison ◽  
B. Hostachy ◽  
S. P. Benimadhu ◽  
H. R. Pappu
Keyword(s):  
Disease Incidence ◽  
Consensus Sequence ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Das Elisa

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by thrips (Thrips tabaci Lindeman) is an economically important viral pathogen of bulb and seed onion (Allium cepa) crops in many onion-growing areas of the world (2,3). In Africa, IYSV has been reported in Reunion (4) and South Africa (1). In June 2008, diamond-shaped lesions that are typical of IYSV were observed on onion seed scapes in an onion plot of 0.25 ha at Reduit in the central part of Mauritius. Disease incidence was 80% with a severity of 50 to 75% of the scape surface area. Lodging was observed in 25% of the symptomatic plants. Twenty-two symptomatic plants were tested and found to be positive for IYSV when tested by double antibody sandwich (DAS)-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). The presence of the virus was confirmed by reverse transcription (RT)-PCR tests with primers 917L: 5′-TAAAACTTAACTAACACAAA-3′ and 56U: 5′-TCCTAAGTATTCACCAT-3′ as forward and reverse primers, respectively, for specific sequences flanking the CP gene. Another set of primers specific to the small (S) RNA of IYSV (5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTT AACAAGCAC-3′) produced an amplicon of approximately 1.2 kb that includes the 772-bp nucleocapsid (N) gene. The 1.2-kb amplicon was cloned and four clones were sequenced and consensus sequence was used for comparisons. Sequence analysis showed that the N gene of the IYSV isolate from Mauritius (GenBank Accession No. HM218822) shared the highest nucleotide sequence identity (99%) with several known IYSV N gene sequences (Accession Nos. FJ785835 and AM900393) available in the GenBank, confirming the presence of IYSV in the onion crops in Mauritius. A survey was subsequently carried out from July to November 2008 in major onion-growing localities at La Marie, Henrietta, Reduit, and Plaine Sophie (center); Bassin, La Ferme, and La Chaumiere (west); Grand Sable, Petit Sable, and Plaisance (south, southeast); and Belle Mare, Trou d'Eau Douce, and Palmar (east) to monitor the distribution of the disease on the island. Symptomatic samples with diamond-to-irregularly shaped lesions were observed and 155 symptomatic and 35 nonsymptomatic samples were collected and screened by DAS-ELISA for IYSV and Tomato spotted wilt virus (TSWV), another tospovirus reported to infect onion elsewhere. Sixty-six percent of the symptomatic samples screened (102 of 155) tested positive for IYSV. No IYSV was detected in the symptomless samples. There was no serological indication of TSWV infection in the samples. Samples that tested positive for IYSV were collected from Belle mare, Palmar, and Trou d'eau douce in the east and La Ferme in the west. Cultivars infected were Gandiole, Local Red, and Veronique. No IYSV was detected in the bulbs. The vector, T. tabaci, was observed in infected onion parcels surveyed and is known to occur in all onion-producing areas of the island. To our knowledge, this is the first report of IYSV in onion in Mauritius. Further surveys and monitoring of IYSV incidence, along with its impact on the yield, need to be established. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Symptomatology of Iris yellow spot virus in Selected Indicator Hosts

2009 ◽  
Vol 10 (1) ◽  
pp. 41 ◽  
Author(s):  
Sudeep Bag ◽  
H. R. Pappu
Keyword(s):  
Plant Species ◽  
Biological Diversity ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Mechanical Inoculation ◽  
Spot Virus ◽  
Seed Crops

Thrips-transmitted Iris yellow spot virus is an economically important pathogen of onion bulb and seed crops. To better understand the biological diversity of IYSV, several plant species were evaluated for their response to mechanical inoculation with IYSV under controlled greenhouse conditions. Accepted for publication 3 June 2009. Published 24 August 2009.

scholarly journals First Report of Iris yellow spot virus Infecting Green Onion in Indonesia

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1665-1665 ◽  
Author(s):  
H. R. Pappu ◽  
A. Rauf
Keyword(s):  
Consensus Sequence ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Fta Cards ◽  
Field Samples

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5′-AGCAAAGTGAGAGGACCACC-3′ and IYSV-239f: 5′ TGAGCCCCAATCAAGACG3′ (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 96:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals Identification of New Alternative Weed Hosts for Iris yellow spot virus in the Pacific Northwest

Plant Disease ◽  
2007 ◽  
Vol 91 (12) ◽  
pp. 1683-1683 ◽  
Author(s):  
R. K. Sampangi ◽  
S. K. Mohan ◽  
H. R. Pappu
Keyword(s):  
Plant Species ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
N Gene ◽  
Rt Pcr ◽  
Weed Species ◽  
Spot Virus ◽  
Viral Pathogen ◽  
Redroot Pigweed

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an economically important viral pathogen of onion bulb and seed crops in several parts of the United States and the world (1). IYSV is primarily transmitted by onion thrips (Thrips tabaci) and there is no evidence of seed transmission (1). However, susceptible cultivated and weed species could serve as reservoirs of inoculum from which thrips could acquire the virus to introduce and spread it in onion fields. Samples from asymptomatic and symptomatic volunteer onion plants in some of the commonly cultivated crops in the region (corn, wheat, grapes, mint, carrot, alfalfa, and sugar beets) and several common weeds in and around onion bulb and seed fields with a history of IYSV in Idaho and Washington were collected during the months of July, August, September and October of 2006. More than 175 samples from 35 plant species were analyzed for IYSV by a commercially available ELISA kit (Agdia Inc., Elkhart, IN). With the exception of a few volunteer onions, none of the other plant species had any symptoms of virus infection. Symptoms on volunteer onions included characteristic diamond-shaped lesions. To confirm the presence of IYSV in the ELISA-positive samples, total nucleic acids were extracted (2) and used in a reverse transcription (RT)-PCR assay (3). The primer pair consisted of 5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′. This primer pair flanks the nucleocapsid (N) gene of IYSV and generates an approximate 1.2-kb amplicon (3) that includes the complete N gene. An amplicon of expected size was obtained from each IYSV-positive sample. The amplicons were cloned and sequenced. There was a 95% sequence identity with known IYSV sequences. While several weed species gave ELISA values that suggested the presence of IYSV, results of RT-PCR assays failed to confirm the presence of the virus. This discrepancy between ELISA and RT-PCR results could be due to nonspecific reaction in ELISA (4) or difficulty associated with obtaining RT-PCR-quality templates for amplification. Only volunteer onions and the following weeds tested positive for IYSV by ELISA and RT-PCR: redroot pigweed (Amaranthus retroflexus), puncturevine (Tribulus terrestris), kochia (Kochia scoparia), prickly lettuce (Lactuca serriola), and common lambsquarters (Chenopodium album). Of these, redroot pigweed was recently reported to be ELISA-positive for IYSV (1). This information on the wider natural host range of IYSV, including potential alternative hosts that could serve as virus reservoirs, is useful for a better understanding of the disease epidemiology and in developing an integrated management strategy for reducing the impact of this disease. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. HortScience 40:697, 2005. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

scholarly journals Iris Yellow Spot Virus in Onion Bulb and Seed Crops in Washington

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 222-222 ◽  
Author(s):  
L. J. du Toit ◽  
H. R. Pappu ◽  
K. L. Druffel ◽  
G. Q. Pelter
Keyword(s):  
United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Rt Pcr ◽  
Spot Virus ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops ◽  
Np Gene

The geographic distribution of Iris yellow spot virus (IYSV, Genus Tospovirus, Family Bunyaviridae) in onion (Allium cepa L.) crops in the western United States has increased with the most recent report in Colorado (1,4). Furthermore, the incidence of IYSV has increased significantly in onion crops in the Treasure Valley of southern Idaho and eastern Oregon, where the disease was first detected in the United States (1,2). Surveys of onion seed crops in Washington during the past 2 years showed the presence of plants with symptoms characteristic of IYSV infection, including distinct diamond-shaped chlorotic or necrotic lesions, as well as indistinct circular to irregular, chlorotic or necrotic lesions of various sizes on the scapes of flowering plants. To date, symptomatic plants have been observed in five seed crops in Washington, at incidences ranging from <1% to approximately 20% in individual seed crops. Enzyme-linked immunosorbent assays carried out directly on symptomatic onion samples collected in July 2002, and on Nicotiana benthamiana plants mechanically inoculated with sap from these symptomatic plants, did not detect the presence of IYSV. In late July 2003, symptomatic plants were collected from an onion seed crop in Grant County and tested for IYSV infection by reverse transcription-polymerase chain reaction (RT-PCR). Total nucleic acid was extracted from symptomatic areas of the scapes with the procedure described by Presting et al. (3). Primers specific to the nucleocapsid (NP) gene of IYSV were designed based on sequences in GenBank: 5′-TCA GAA ATC GAG AAA CTT-3′ and 5′-TAA TTA TAT CTA TCT TTC TTG G-3′ (sense and antisense polarity, respectively). The RT-PCR assay produced an amplicon of the expected size (approximately 700 bp) that was cloned and sequenced. Comparison with the GenBank IYSV gene sequences showed 98% sequence identity of the NP gene. In August 2003, symptoms of IYSV infection were observed in two onion bulb crops, each located within 2 miles of the symptomatic onion seed crop in Grant County. The presence of IYSV in these crops was confirmed by RT-PCR with cloning and sequencing of the amplicon, as described for the seed crop samples. To our knowledge, this is the first confirmation of IYSV in onion bulb and seed crops in Washington, where 16,000 to 18,000 acres of onion bulb crops and 700 to 900 acres of onion seed crops are grown annually (USDA National Agricultural Statistics Service). The increase in prevalence of IYSV in the Pacific Northwest highlights the need for additional research to clarify the epidemiology of this potentially significant pathogen and to develop a regional management program for iris yellow spot. References: (1) J. M. Hall et al. Plant Dis. 77:952, 1993. (2) J. W. Moyer et al. (Abstr.) Phytopathology 93(suppl.):S115, 2003. (3) G. G. Presting et al. Phytopathology 85:436, 1995. (4) H. F. Schwartz et al. Plant Dis. 86:560, 2002.

scholarly journals First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 468-468 ◽  
Author(s):  
D. H. Gent ◽  
R. R. Martin ◽  
C. M. Ocamb
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
First Report ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

Sign in / Sign up

Export Citation Format

Share Document