scholarly journals First record of Apocorophium acutum (Chevreux, 1908) (Amphipoda, Corophiidae, Corophiinae) from Uruguay, with notes on the biology and distribution

Check List ◽  
2018 ◽  
Vol 14 (6) ◽  
pp. 1169-1173
Author(s):  
Álvaro Demicheli ◽  
Ana Verdi
Keyword(s):  
Ballast Water ◽  
Morphological Characteristics ◽  
First Record ◽  
South American ◽  
Worldwide Distribution

The amphipod Apocorophium acutum (Chevreux, 1908) has a worldwide distribution due to dispersion by ballast water and the hulls of ships. Here we provide a record of this species from Rocha department, Uruguay, which is the first record in the Atlantic South American coast. This record is 5,400 km from the nearest previously known record in Venezuela. Images and morphological characteristics are provided to distinguish from other species of Corophiidae previously recorded in the country.

scholarly journals First record of Apocorophium acutum (Chevreux, 1908) (Amphipoda, Corophiidae, Corophiinae) from Uruguay, with notes on the biology and distribution

Check List ◽  
2018 ◽  
Vol 14 (6) ◽  
pp. 1169-1173
Author(s):  
Álvaro Demicheli ◽  
Ana Verdi
Keyword(s):  
Ballast Water ◽  
Morphological Characteristics ◽  
First Record ◽  
South American ◽  
Worldwide Distribution

The amphipod Apocorophium acutum (Chevreux, 1908) has a worldwide distribution due to dispersion by ballast water and the hulls of ships. Here we provide a record of this species from Rocha department, Uruguay, which is the first record in the Atlantic South American coast. This record is 5,400 km from the nearest previously known record in Venezuela. Images and morphological characteristics are provided to distinguish from other species of Corophiidae previously recorded in the country.

The First Record of Parthenitae and Cercariae of Plagiorchis Multiglandularis (Trematoda, Plagiorchiidae) in Lymnaea Stagnalis in Ukraine

2018 ◽  
Vol 52 (4) ◽  
pp. 289-294
Author(s):  
E. P. Zhytova
Keyword(s):  
Lymnaea Stagnalis ◽  
Morphological Characteristics ◽  
First Record ◽  
Morphometric Data ◽  
Diagnostic Characters ◽  
Plagiorchis Elegans

Abstract Parthenitae and cercariae of Plagiorchis. multiglandularis Semenov, 1927 are recorded in Lymnaea stagnalis (Linnaeus, 1758) for the fi rst time in Ukraine; their morphological characteristics are specifi ed. Diagnostic characters of P. multiglandularis parthenitae and cercariae found in Ukrainian Polissia are compared with those from other regions. To confi rm the validity of the species, a comparison of the morphometric data of this trematode larvae with the cercariae of Plagiorchis elegans (Rudolphi, 1802) Braun, 1902, found in molluscs L. stagnalis, L. ralustris and L. corvuses, was performed. It was determined that P. multiglandularis cercariae diff er from those of P. elegans in size and position of the penetration glands.

Tupinambine teiids from the middle Miocene of north-western Patagonia (Argentina)

2008 ◽  
Vol 29 (3) ◽  
pp. 425-431 ◽  
Author(s):  
Santiago Brizuela ◽  
Adriana María Albino
Keyword(s):  
Geographical Distribution ◽  
Middle Miocene ◽  
First Record ◽  
South American ◽  
The South ◽  
North Western

Abstract Remains of teiids assignable to the Tupinambinae (Tupinambis sp. or Crocodilurus sp.) are here described from the middle Miocene Collón Curá Formation at Cañadón del Tordillo, in Neuquén province, Argentina. No tupinambine species presently inhabits the region of the fossil locality. The fossils represent the westernmost distribution of fossil tupinambine teiids in Patagonia, enlarging the known geographical distribution of the teiids through the Miocene in a longitudinal range. Also, they constitute the first record of lizards from the Colloncuran SALMA, partially filling the record of tupinambine teiids for the South American Miocene.

Prevalence and genetic diversity of viruses associated with rugose wood complex in Greek vineyards

Plant Disease ◽  
2021 ◽  
Author(s):  
Chrysoula Orfanidou ◽  
Kalliopi Moraki ◽  
Polina Panailidou ◽  
Leonidas Lotos ◽  
Asimina T Katsiani ◽  
...  
Keyword(s):  
Phylogenetic Trees ◽  
First Record ◽  
Grapevine Virus ◽  
Multiple Introductions ◽  
Worldwide Distribution ◽  
Grapevine Virus A ◽  
Transmission Modes ◽  
Virus Incidence ◽  
Grapevine Virus B ◽  
Rupestris Stem Pitting

Rugose wood is one of the most important disease syndromes of grapevine and it has been associated with at least three viruses: grapevine rupestris stem pitting associated virus (GRSPaV), grapevine virus A (GVA) and grapevine virus B (GVB). All three viruses show a worldwide distribution pattern, and their genetic composition has been the focus of extensive research over the past years. Despite their first record in Greece almost 20 years ago, there is a lack of knowledge on the distribution and genetic variability of their populations in Greek vineyards. In this context, we investigated the distribution of GRSPaV, GVA and GVB in rootstocks, self-rooted and grafted grapevine cultivars, originating from different geographic regions that are representing important viticultural areas of Greece. Three new RT-PCR assays were developed for the reliable detection of GRSPaV, GVA and GVB. Our results indicated that GVA is the most prevalent in Greek vineyards, followed by GRSPaV and GVB. However, virus incidence differed among self-rooted and grafted grapevine cultivars or rootstocks tested. Selected isolates from each virus were further molecularly characterized to determine their phylogenetic relationships. All three viruses exhibited high nucleotide diversity, which was depicted in the constructed phylogenetic trees. Isolates from Greece were placed in various phylogroups, reinforcing the scenario of multiple introductions of GVA, GVB and GRSPaV in Greece and highlighting the effect of different transmission modes in the evolutionary course of the three viruses.

scholarly journals New records, a completed list and identification key of mites (Acari) associated with the stable fly, Stomoxys calcitrans (L.) (Diptera: Muscidae)

Acarologia ◽  
2018 ◽  
Vol 59 (1) ◽  
pp. 3-11
Author(s):  
Jenő Kontschán ◽  
Sándor Hornok
Keyword(s):  
First Record ◽  
Mite Species ◽  
Identification Key ◽  
Stomoxys Calcitrans ◽  
Stable Fly ◽  
Stable Flies ◽  
Worldwide Distribution ◽  
Blood Sucking ◽  
The Family ◽  
Medical Importance

The stable fly, Stomoxys calcitrans (L.) is a blood-sucking muscid fly species, with a worldwide distribution and high veterinary-medical importance. In this study, four mite species were collected from stable flies in Hungary. One mite species (Trichotrombidium muscarum (Riley, 1878)) from the family Microtrombidiidae was parasitic on the flies, collected in high numbers from their bodies. The other three species were found in small numbers on the flies, which they use only for transportation. The latter included the phoretic female of Pediculaster mesembrinae (Canestrini, 1881) (Acari: Siteroptidae), the phoretic deutonymph of the Halolaelaps sexclavatus (Oudemans, 1902) (Acari: Halolaelapidae) and Macrocheles subbadius (Berlese, 1904) (Acari: Macrochelidae). This is the first record of an association between the stable fly and two mite species (Trichotrombidium muscarum and Halolaelaps sexclavatus). A new, completed list and identification key of known stable fly associated mites are also provided.

scholarly journals Andrena Florivaga Eversmann , 1852 (Hymenoptera: Apoidea: Andrenidae) - A New Bee Species of the Genus Andrena in Poland

2013 ◽  
Vol 57 (1) ◽  
pp. 45-50
Author(s):  
Józef Banaszak ◽  
Ewelina Motyka ◽  
Katarzyna Szczepko
Keyword(s):  
National Park ◽  
Morphological Characteristics ◽  
First Record ◽  
General Distribution ◽  
Baikal Lake ◽  
The West ◽  
Central Siberia ◽  
Lake Region ◽  
Time Period ◽  
Pan Traps

Summary The first record of Andrena florivaga Eversmann, 1852 is reported from Poland on the basis of specimens collected in the Kampinos National Park (Mazovian Lowland). Diagnosis, data on localities, biology, and general distribution of the species are provided. One female and five males were caught on a mowed fresh meadow and fallow fields with the use of water pan-traps (Moericke traps), during the 2003 - 2004 time period. The main morphological characteristics distinguishing Andrena florivaga from the very similar Andrena dorsalis Brullé, 1832 species and from the other species of the subgenus Lepidandrena are: in the case of females - the width of facial foveae and colouration of legs, and in the case of males - the length of the first flagellar segment, colouration of clypeus, and pubescence of gonostyles. Andrena florivaga can be found from France in the west, to Central Siberia (Baikal lake region) in the east, and Turkey in the south. Poland is the northernmost locality of the species.

scholarly journals A new terrestrial snail species (Gastropoda: Bulimulidae) from the Región de Antofagasta, northern Chile

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3538
Author(s):  
Juan Francisco Araya ◽  
Abraham S.H. Breure
Keyword(s):  
New Species ◽  
Coastal Area ◽  
First Record ◽  
Coastal Areas ◽  
Snail Species ◽  
South American ◽  
Northern Chile ◽  
Terrestrial Snails ◽  
A New Species ◽  
Coastal Range

A new species of Scutalus Albers, 1850 (Gastropoda: Bulimulidae), Scutalus chango sp. n., is described from a coastal area of northern Chile. Empty shells of this new species were found buried in sand and under boulders and rocks in the foothills of the Chilean Coastal Range at Paposo, Región de Antofagasta. This new species is distinguished from all other Chilean terrestrial snails by its slender shell with a flared and reflected aperture, and by the presence of a columellar fold. This is the first record of Scutalus in Chile, and the southernmost record for this endemic South American bulimulid genus. The presence of this species in Paposo highlights the need for further research and for conservation guidelines in coastal areas of northern Chile, which have comparatively high levels of biodiversity and endemism.

scholarly journals First Report of Meloidogyne enterolobii on Carrot in China

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1019-1019 ◽  
Author(s):  
Y. F. Wang ◽  
S. Xiao ◽  
Y. K. Huang ◽  
X. Zhou ◽  
S. S. Zhang ◽  
...  
Keyword(s):  
Morphological Characteristics ◽  
Severe Infection ◽  
Original Description ◽  
First Record ◽  
Vegetable Crops ◽  
Species Identity ◽  
Fujian Province ◽  
First Report ◽  
Lateral Lines ◽  
Meloidogyne Sp

Carrot (Daucus carota var. sativus) is one of the 10 most economically important vegetable crops in the world. Recently, stunted and yellowing carrots grown on sandy soil in several commercial fields were observed in Dongshan County, Fujian Province, China. Many round to irregular shaped lumps and swellings were present on the surface of tap and fibrous roots, often with secondary roots emerging from the galls on taproots. Severe infection caused short, stubby, forked taproots leading to losses in quality and marketability. Meloidogyne sp. females and egg masses were dissected from the galls. The perineal patterns from 20 females were oval shaped with moderate to high dorsal arches and mostly lacking obvious lateral lines. The second-stage juvenile mean body length (n = 20) was 416 (390 to 461) μm; lateral lips were large and triangular in face view; tail was thin and length was averaged 56.1 (49.8 to 62.1) μm, with a broad, bluntly rounded tip. These morphological characteristics matched the original description of M. enterolobii (5). Species identity was further explored by sequencing the mitochondrial DNA (mtDNA) region between COII and the lRNA genes using primers C2F3/MRH106 (GGTCAATGTTCAGAAATTTGTGG/AATTTCTAAAGACTTTTCTTA GT) (4). A DNA fragment of ~840 bp was obtained and the sequence (GenBank Accession No. KJ146864) was compared with those in GenBank using BLAST and was 100% identical to the sequences of M. enterolobii and M. mayaguensis, a synonym of M. enterolobii (4). Part of the rDNA spanning ITS1, 5.8S gene, ITS2 was amplified with primers V5367/26S (TTGATTACGTCCCTGCCCTTT/TTTCACTCGCCGTTACTAAGG) (3), and the sequence obtained (KJ146863) was 99 to 100% identical to sequences of M. enterolobii (KF418369.1, KF418370.1, JX024149.1, and JQ082448.1). For further confirmation, M. enterolobii specific primers Me-F/Me-R (AACTTTTGTGAAAGTGCCGCTG/TCAGTTCAGGCAGGATCAACC) (2) were used for amplification of the rDNA-IGS2 sequences of eight populations of the nematode from three localities. A 200-bp amplification product was produced by each population, whereas no product was amplified from control populations of M. incognita or M. javanica. A single product of ~320 bp was obtained using primers 63VNL/63VTH (GAAATTGCTTTATTGTTACTAAG/TAGCCACAGCAAAATAGTTTTC ) (1) from the mtDNA 63-bp repeat region for these populations, and the sequence (KJ146861) showed 100% identity with sequences of M. enterolobii (AJ421395.1, JF309159.1, and JF309160.1). Therefore, the population of Meloidogyne sp. on carrot was confirmed to be M. enterolobii. This nematode has been reported to infect more than 20 plant species belonging to seven families, including Annonaceae, Cucurbitaceae, Convolvulaceae, Fabaceae, Marantaceae, Myrtaceae, and Solanaceae in China. To our knowledge, this is the first report of infection of carrot by M. enterolobii and the first record of M. enterolobii parasitizing a plant in the family Apiaceae in China. M. enterolobii has been reported in Guangdong and Hainan provinces, China. This is the first report of M. enterolobii in Fujian Province, in southeast China. References: (1) V. C. Blok et al. Nematology 4:773, 2002. (2) H. Long et al. Acta Phytopathol. Sin. 36:109, 2006. (3) T. C. Vrain et al. Fundam. Appl. Nematol. 15:565, 1992. (4) J. Xu et al. Eur. J. Plant Pathol. 110:309, 2004. (5) B. Yang and J. D. Eisenback. J. Nematol. 15:381, 1983.

scholarly journals First record of intersexuality in Porcellana platycheles (Pennant, 1777) (Decapoda: Anomura: Porcellanidae)

2017 ◽  
Vol 41 (3) ◽  
pp. 606-610
Author(s):  
Luciane Ferreira ◽  
Guillermo Guzmán
Keyword(s):  
Morphological Characteristics ◽  
First Record ◽  
Genetic Variations ◽  
The Third ◽  
The Family

This paper reports the first record of intersexuality from Porcellana platycheles, a member of the family Porcellanidae. Intersex individuals were identified by the presence of both pairs of genital openings on the coxae of the third and fifth pereiopods respectively, and by morphological characteristics of the abdomen and pleopods. The low occurrence of this condition suggests that intersexuality is due to genetic variations in the population rather than other possible causes of intersexuality previously reported in other decapods.

scholarly journals First Report of Myrothecium roridum Causing Leaf Spot on Zantedeschia aethiopica in China

Plant Disease ◽  
2014 ◽  
Vol 98 (6) ◽  
pp. 854-854 ◽  
Author(s):  
B.-J. Li ◽  
H.-Y. Ben ◽  
Y.-X. Shi ◽  
X.-W. Xie ◽  
A.-L. Chai
Keyword(s):  
Leaf Spot ◽  
Morphological Characteristics ◽  
Its Region ◽  
First Record ◽  
Conidial Suspension ◽  
Isolation And Identification ◽  
Zantedeschia Aethiopica ◽  
Calla Lily ◽  
Initial Symptoms ◽  
Myrothecium Roridum

Zantedeschia aethiopica (L.) Spreng. (calla lily), belonging to family Araceae, is a popular ornamental plant in China. In the summer of 2010, leaves of calla lily with typical symptoms of necrotic lesions were observed in a commercial glasshouse in Beijing, China (116°20′ E, 39°44′ N). The initial symptoms were circular to subcircular, 1 to 3 mm, and dark brown lesions on the leaf lamina. Under high humidity, lesions expanded rapidly to 5 to 10 mm with distinct concentric zones and produced black sporodochia, especially on the backs of leaves. Later, the infected leaves were developing a combination of leaf lesions, yellowing, and falling off; as a result, the aesthetic value of the plant was significantly impacted. Leaf samples were used in pathogen isolation. Symptomatic leaf tissues were cut into small pieces and surface sterilized with 70% ethanol for 30 s and then in 0.1% mercuric chloride solution for 1 to 3 min. After being washed in sterile distilled water three times, the pieces were plated on potato dextrose agar (PDA) and incubated at 25°C in darkness for 7 days (5). Initial colonies of isolates were white, floccose mycelium and developed dark green to black concentric rings that were sporodochia bearing viscid spore masses after incubating 5 days. Conidiophores branched repeatedly. Conidiogenous cells were hyaline, clavate, and 10.0 to 16.0 × 1.4 to 2.0 μm. Conidia were hyaline, cylindrical, both rounded ends, and 6.0 to 8.2 × 1.9 to 2.4 μm. Morphological characteristics of the fungus were consistent with the description of Myrothecium roridum Tode ex Fr. (3,4). To confirm the pathogenicity, three healthy plants of calla lily were inoculated with a conidial suspension (1 × 106 conidia per ml) brushed from a 7-day-old culture of the fungus. Control plants were sprayed with sterile water. The inoculated plants were individual with clear plastic bags and placed in a glass cabinet at 25°C. After 7 days, all inoculated leaves developed symptoms similar to the original samples, but control plants remained disease free. Re-isolation and identification confirmed Koch's postulates. For molecular identification, genomic DNA of a representative isolate (MTL07081001) was extracted by modified CTAB method (1), and the rDNA-ITS region was amplified by using primers ITS1 (5-TCCGTAGGTGAACCTGCGG-3) and ITS4 (5-TCCTCCGCTTATTGATATGC-3). The 465-bp amplicon (GenBank Accession No. KF761293) was 100% identity to the sequence of M. roridum (JF724158.1) from GenBank. M. roridum has an extensive host range, covering 294 host plants (2). To our knowledge, this is the first record of leaf spot caused by M. roridum on calla lily in China. References: (1) F. M. Ausubel et al. Current Protocols in Molecular Biology. John Wiley & Sons Inc, New York, 1994. (2) D. F. Farr and A. Y. Rossman, Fungal Databases. Syst. Mycol. Microbiol. Lab., ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , October 2013. (3) M. T. Mmbaga et al. Plant Dis. 94:1266, 2010. (4) Y. X. Zhang et al. Plant Dis. 95:1030, 2011. (5) L. Zhu et al. J. Phytopathol. 161:59, 2013.

Sign in / Sign up

Export Citation Format

Share Document