scholarly journals Cell cycle analysis and interspecies nuclear transfer of cat cells treated with chemical inhibitors

2014 ◽  
Vol 62 (2) ◽  
pp. 233-242 ◽  
Author(s):  
Manita Wittayarat ◽  
Akira Fujiwara ◽  
Kaywalee Chatdarong ◽  
Mongkol Techakumphu ◽  
Yoko Sato ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Nuclear Transfer ◽  
Donor Cell ◽  
Fusion Rate ◽  
Cell Cycle Analysis ◽  
Control Group ◽  
Fibroblast Cells ◽  
Cell Stage ◽  
Chemical Inhibitors ◽  
M Phase

This study investigated the effect of chemical inhibitors on the cell-cycle synchronisation in cat fibroblast cells and evaluated the development of interspecies embryos reconstructed from cat donor cells and enucleated bovine oocytes. Cat fibroblast cells were treated with 15 μg/mL roscovitine or 0.05 μg/mL deme-colcine prior to cell cycle analysis and nuclear transfer. The percentage of cat fibroblast cells arrested at the G0/G1 phase in the roscovitine group was similar to that in the control group without any treatment. The percentage of cells arrested at the G2/M phase was significantly higher in the demecolcine group than in the control group. The fusion rate of interspecies couplets was significantly greater in the roscovitine group than in the control group. Most embryos stopped the development at the 2- or 4-cell stage, and none developed into blastocysts. Chemical inhibitor-induced donor cell cycle synchronisation did not overcome developmental arrest in interspecies cloned embryos.

In vitro development of mouse somatic nuclear transfer embryos: effects of donor cell passages and electrofusion

Zygote ◽  
2008 ◽  
Vol 16 (3) ◽  
pp. 223-227 ◽  
Author(s):  
Gang Zhang ◽  
Qing-Yuan Sun ◽  
Da-Yuan Chen
Keyword(s):  
Nuclear Transfer ◽  
Donor Cell ◽  
Fibroblast Cells ◽  
Negative Effects ◽  
Cell Stage ◽  
Kunming Mouse ◽  
Donor Cells ◽  
Significant Difference ◽  
Developmental Rates

SummaryIn this study, C57BL/6 adult male mouse ear fibroblast cells and Kunming mouse M2 oocytes were used as donors and recipients, respectively, to investigate the effect of passage number on donor cells and electrofusion times on the in vitro development of nuclear transfer (NT) embryos. The results demonstrated firstly that when the ear fibroblast cells from either 2–4, 5–7 or 8–10 passages were used as donors, respectively, to produce NT embryos, the number of passages undergone by the donor cells had no significant effect on the in vitro development of NT embryos. The developmental rates for morula/blastocyst were 15.2, 13.3 and 14.0%, respectively, which were not significantly difference (p > 0.05). Secondly, when the NT embryos were electrofused, there was no significant difference between the fusion ratio for the first electrofusion and the second electrofusion (p > 0.05). The developmental rates of the 2-cell and 4-cell stages that had undergone only one electrofusion, however, were significantly higher than those that had had two electrofusions (65.7% compared with 18.4% and 36.4% compared with 6.1%; p < 0.01), furthermore the NT embryos with two electrofusions could not develop beyond the 4-cell stage. This study suggests that this protocol might be an alternative method for mouse somatic cloning, even though electrofusion can exert negative effects on the development of NT embryos.

scholarly journals Effect of the number of passages of fetal and adult fibroblasts on nuclear remodelling and first embryonic division in reconstructed horse oocytes after nuclear transfer

Reproduction ◽  
2003 ◽  
pp. 535-542 ◽  
Author(s):  
X Li ◽  
JL Tremoleda ◽  
WR Allen
Keyword(s):  
Embryonic Development ◽  
Nuclear Transfer ◽  
Metaphase Plate ◽  
Donor Cell ◽  
Fibroblast Cells ◽  
Cell Nuclei ◽  
Cell Stage ◽  
Metaphase Ii Oocytes ◽  
Adult Fibroblasts

The effects of repeated passage in vitro of fetal fibroblast cells (FFC) and adult fibroblast cells (AFC) on nuclear remodelling and first embryonic division when used to reconstruct horse oocytes, and the reasons for the developmental block in progression to the two-cell stage were investigated. A total of 463 metaphase II oocytes produced 427 fibroblast-cytoplasm couplets after nuclear transfer, which finally resulted in 319 reconstructed oocytes. With increasing numbers of passages, the rates of nuclear remodelling decreased in both types of donor cell; about half of the fused donor cell nuclei showed the S-G2-prometaphase stages of the first embryonic division 18-20 h after cell-fusion treatment, irrespective of the number of donor cell passages (FFC: 49%; AFC: 53%). The rates of first embryonic division in the reconstructed oocytes fell with increasing age of the donor cells (FFC: 32%-26%-23%; AFC: 27%-23%-24%) and these rates were significantly lower than those obtained from metaphase II oocytes activated parthenogenetically (79%, P < 0.05). Microscopic analysis of the organization of the first embryonic division in the developmentally blocked oocytes reconstructed with either FFC or AFC showed that most of these (FFC: 78%; AFC: 92%) could not form the mitotic spindle and the metaphase plate of chromosomes. These findings indicate that either fetal or adult fibroblasts that have undergone relatively few passages in vitro are most suitable as donors. However, both types of cell have lower potential to restart first embryonic development after nuclear transfer than do the equivalent cells in other species. Improvement in the rate of donor cell nuclear progression from S-G2-prometaphase to beyond the metaphase stage, and the normal organization of first embryonic development in reconstructed horse oocytes, would seem to be the key to the production of cloned embryos in this species.

scholarly journals Characterization of p96h2bk: immunoreaction with an anti-Erk(extracellular-signal-regulated kinase) peptide antibody and activity in Xenopus oocytes and eggs

1998 ◽  
Vol 335 (1) ◽  
pp. 43-50
Author(s):  
Dong-Hua CHEN ◽  
Chin-Tin CHEN ◽  
Yong ZHANG ◽  
Mei-Ann LIU ◽  
Roberto CAMPOS-GONZALEZ ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Cell Cycle Arrest ◽  
Xenopus Oocytes ◽  
Protein Kinase Activity ◽  
Cell Stage ◽  
Extracellular Signal Regulated Kinase ◽  
Oncogenic Ras ◽  
Cycle Arrest ◽  
Extracellular Signal ◽  
M Phase

We have shown previously that oncogenic Ras induces cell cycle arrest in activated Xenopus egg extracts [Pan, Chen and Lin (1994) J. Biol. Chem. 269, 5968–5975]. The cell cycle arrest correlates with the stimulation of a protein kinase activity that phosphorylates histone H2b in vitro (designated p96h2bk) [Chen and Pan (1994) J. Biol. Chem. 269, 28034–28043]. We report here that p96h2bk is likely to be p96ram, a protein of approx. 96 kDa that immunoreacts with a monoclonal antibody (Mk-1) raised against a synthetic peptide derived from a sequence highly conserved in Erk1/Erk2 (where Erk is extracellular-signal-regulated kinase). This is supported by two lines of evidence. First, activation/inactivation of p96h2bk correlates with upward/downward bandshifts of p96ram in polyacrylamide gels. Secondly, both p96h2bk and p96ram can be immunoprecipitated by antibody Mk-1. We also studied the activity of p96h2bk/p96ram in Xenopus oocytes and eggs. p96h2bk/p96ram was inactive in stage 6 oocytes, was active in unfertilized eggs, and became inactive again in eggs after fertilization. Since stage 6 oocytes are at G2-phase of the cell cycle, unfertilized eggs arrest at M-phase and eggs exit M-phase arrest after fertilization, the results thus indicate that p96h2bk/p96ram activity is cell cycle dependent. Moreover, microinjection of oncogenic Ras into fertilized eggs at the one-cell stage arrests the embryos at the two-cell stage, and this induced arrest is correlated with an inappropriate activation of p96h2bk/p96ram. The data are consistent with the concept that inappropriate activation of p96h2bk/p96ram plays a role in the cell cycle arrest induced by oncogenic Ras.

47 DIFFERENTIAL DEVELOPMENTAL ABILITY OF EMBRYOS CLONED FROM TISSUE-SPECIFIC STEM CELLS

2007 ◽  
Vol 19 (1) ◽  
pp. 142
Author(s):  
K. Inoue ◽  
N. Ogonuki ◽  
H. Miki ◽  
S. Noda ◽  
S. Inoue ◽  
...  
Keyword(s):  
Stem Cells ◽  
Nuclear Transfer ◽  
Embryonic Stem ◽  
Donor Cell ◽  
Fibroblast Cell ◽  
High Rate ◽  
Full Potential ◽  
Cell Nuclei ◽  
Cell Stage

Although cloning animals by somatic cell nuclear transfer is generally an inefficient process, use of appropriate donor cell types may improve the cloning outcome significantly. Among the donor cells tested so far, mouse embryonic stem cells have given the best efficiency in terms of the development of reconstructed embryos into offspring. In this study, we examined whether 2 in vitro-produced pluripotent stem cells—neural stem cells (NSCs) and mesenchymal stem cells (MSCs)—could be better nuclear donors than other differentiated cells. Embryos were reconstructed by transfer of nuclei from NSCs or MSCs with full potential for differentiation in vitro. Most (76%) of the 2-cell NCS embryos developed to the 4-cell stage; 43% implanted and 1.6% developed to term after transfer to pseudopregnant recipients. These rates were very similar to those of embryos cloned from fibroblast cell nuclei. Interestingly, in the patterns of zygotic gene expression, NSC embryos were more similar to in vitro-fertilized embryos than fibroblast cloned embryos. By contrast, embryos reconstructed using MSC nuclei showed lower developmental ability and no implantation was obtained after embryo transfer. Chromosomal analysis of the donor MSCs revealed very high frequencies of monosomy and trisomy, which might have caused the very poor post-implantation development of embryos following nuclear transfer. Thus, in vitro-produced pluripotent cells can serve as donors of nuclei for cloning mice, but may be prone to chromosomal aberrations leading to a high rate of cloned embryo death.

24 EFFECTS OF HISTONE METHYLATION RELATED GENES ON EPIGENETIC REPROGRAMMING AND ZYGOTIC GENE ACTIVATION IN OVINE SOMATIC CELL NUCLEAR TRANSFER (SCNT) EMBRYOS

2009 ◽  
Vol 21 (1) ◽  
pp. 112
Author(s):  
I. Choi ◽  
K. H. S. Campbell
Keyword(s):  
Cell Cycle ◽  
Somatic Cell ◽  
Embryo Development ◽  
Somatic Cell Nuclear Transfer ◽  
Nuclear Transfer ◽  
Gene Activation ◽  
Early Embryo ◽  
Cell Stage ◽  
Early Embryo Development ◽  
Zygotic Gene

After fertilization, early embryo development is dependent upon maternally inherited proteins and protein synthesised from maternal mRNA until zygotic gene activation (ZGA) occurs. The transition of transcriptional activity from maternal to embryonic control occurs with the activation of rRNA genes and the formation of the nucleolus at the 8- to 16-cell stage that coincides with a prolonged fourth cell cycle in bovine and ovine embryos. However, previous studies have reported a shift in the longest cell cycle (fifth cell cycle) in bovine somatic cell nuclear transfer (SCNT) embryos, suggesting that the major genome activation is delayed, possibly due to incomplete changes in chromatin structure such as hypermethylation and hypoacetylation of histone (Memili and First 2000 Zygote 8, 87–96; Holm et al. 2003 Cloning Stem Cells 5, 133–142). Although global gene expression profile studies have been carried out in somatic cell nuclear transfer embryos, little is known about the expression of genes which can alter chromatin structure in early embryo development and possibly effect ZGA. To determine whether epigenetic reprogramming of donor nuclei affected ZGA and expression profiles in SCNT embryos, ZBTB33 (zinc finger and BTB domain containing 33, also known as kaiso, a methy-CpG specific repressor), BRG1(brahma-related gene 1, SWI/SNF family of the ATP-dependent chromatin remodeling complexes), JMJD1A (jumonji domain containing 1A, H3K9me2/1-specific demethylase), JMJD1C (putative H3K9-specific demethylase), and JMJD2C (H3K9me3-specific demethylase) were examined by RT-PCR at different developmental stages [germinal vesicle (GV), metaphase II (MII), 8- to 16-cell, 16- to 32-cell, and blastocyst in both parthenogenetic and SCNT embryos]. All genes were detected in parthenogenetic and SCNT blastocyts, and ZBTB33 was also expressed in all embryos at all stages tested. However, the onset of expression of JMJD1C, containing POU5F1 binding site at 5′-promoter region and BRG1 required for ZGA are delayed in SCNT embryos as compared to parthenotes (16- v. 8-cell, and blastoocyst v. 16-cell stage). Furthermore, JMJD2C containing NANOG binding sites at the 3′-flanking region was expressed in GV and MII oocytes and parthenogenetic blastocysts, whereas in SCNT embryos, JMJD2C was only observed from the 16-cell stage onwards. Interestingly, JMJD1A, which is positively regulated by POU5F1, was not detected in GV and MII oocytes but was present in blastocyst stage embryos of both groups. Taken together, these results suggest that incomplete epigenetic modifications of genomic DNA and histones lead to a delayed onset of ZGA which may affect further development and establishment of totipotency. Subsequently, aberrant expression patterns reported previously in SCNT embryos may be attributed to improper expression of histone H3K9 and H3K4 demethylase genes during early embryo development.

44 IN VITRO DEVELOPMENT OF INTERSPECIES NUCLEAR TRANSFER EMBRYOS GENERATED WITH BOVINE OOCYTES AND EQUINE SKIN FIBROBLASTS

2011 ◽  
Vol 23 (1) ◽  
pp. 128
Author(s):  
J. Lee ◽  
J. Park ◽  
Y. Chun ◽  
W. Lee ◽  
K. Song
Keyword(s):  
Nuclear Transfer ◽  
Polar Body ◽  
Donor Cell ◽  
Skin Fibroblasts ◽  
Developmental Competence ◽  
Cleavage Rate ◽  
Cell Stage ◽  
Bovine Oocytes

Study for equine somatic cell nuclear transfer (SCNT) is an attractive field for research, but it has not been a major field of study because it is hard to obtain a sufficient number of ovaries and it takes a lot of time and effort for the recovery of oocytes matured in vivo by ovum pickup. It was reported that the bovine cytoplast could support the remodelling of equine donor cells (Zhou et al. 2007 Reprod. Domest. Anim. 42, 243–247). The objectives of this study are 1) to monitor the early events of equine SCNT by interspecies SCNT (isSCNT) between bovine cytoplast and equine donor cell, and 2) to investigate the developmental competence of isSCNT embryos. Bovine oocytes were recovered from the follicles of slaughtered ovaries, and matured in TCM-199 supplemented with 10 mU mL–1 FSH, 50 ng mL–1 EGF, and 10% FBS at 39°C under 5% CO2 in air for 22 h. Fibroblasts derived from bovine or equine skin tissues were synchronized at G0/G1 stage by contact inhibition for 72 h. After IVM, oocytes with polar body were enucleated and electrically fused with equine or bovine skin fibroblasts (1.0 kV cm–1, 20 μs, 2 pulses). Fused couplets were activated with 5 μM ionomycin for 4 min followed by 5 h culture in 10 μg mL–1 cycloheximide (CHX) and/or 2 mM 6-DMAP, and cultured in modified synthetic oviduct fluid (mSOF) at 39°C under 5% CO2, 5% O2, and 90% N2 for 7 days. All analyses were performed using SAS (version 9.1; SAS Institute, Cary, NC, USA). The cleavage rate of isSCNT embryos derived from equine cell was not different (252/323, 78.7%; P = 0.94) from that of SCNT embryos derived from bovine cell (230/297, 79.2%). However, the rate of isSCNT embryos developed to over 8-cell stage was lower (3.3%; P < 0.0001) than that of bovine SCNT embryos (39.4%), and total cell number of isSCNT embryos developed to over 8-cell stage was lower (17.5, n = 12; P < 0.0001) than that (80.8, n = 110) of bovine SCNT embryos. Also, the rate of blastocyst formation of isSCNT embryos (0/323; 0.0%) was lower (P < 0.0001) than that of bovine SCNT embryos (83/297; 29.3%). Meanwhile, reconstructed oocytes for isSCNT were fixed at 8 h after activation to investigate the formation of pseudo-pronucleus (PPN) after post-activation treatment with CHX or CHX+6-DMAP. The ratio of oocytes with single PPN after treatment with CHX+6-DMAP (26/35; 74.3%) was not different (P = 0.63) from that of oocytes treated with CHX (24/36; 68.1%). Although isSCNT embryos derived from bovine cytoplast and equine donor cell could not develop to more than the 16-cell stage, it is believed that the results of this isSCNT study could be used for the preliminary data regarding the reprogramming of donor cell in equine SCNT.

59 HISTONE DEACETYLASE 1 KNOCK-DOWN IN BOVINE FIBROBLAST CELLS AND CLONED EMBRYOS

2012 ◽  
Vol 24 (1) ◽  
pp. 141
Author(s):  
Z. W. Wang ◽  
P. Zhang ◽  
S. Zhang ◽  
X. Ma ◽  
Y. P. Yin ◽  
...  
Keyword(s):  
Histone Deacetylase ◽  
Nuclear Transfer ◽  
Expression Vector ◽  
Mrna Level ◽  
Negative Control ◽  
Control Group ◽  
Fibroblast Cells ◽  
Control Vector ◽  
Histone Deacetylase 1 ◽  
Donor Cells

Histone deacetylase 1 (HDAC1) is one of the most conserved enzymes present in the nuclei of cells. It was thought to be the most important enzyme in the regulation of histone deacetylation process. However, the function of HDAC1 in bovine fibroblast cells and nuclear transfer embryos is not clear. In the present study, sh299 (5′GCAAGCAGATGCAGAGATTTCAAGA GAATCTCTGCATCTGCTTGCTT3′) targeting of HDAC1 mRNA sequence was designed in the PGP/U6/GFP vector (short hairpin RNA, shRNA, expression vector). The sh299 vector was transfected into bovine fibroblast cells by transfection reagent FuGENE HD and the positive cells were identified by the expression of green fluorescent protein (GFP). Histone deacetylase 1 down-regulation in bovine fibroblast cells was measured by quantitative real-time PCR (qRT-PCR with the 2–ΔΔCT method) at 48 h after sh299 vector transfection at mRNA level. Immunocytochemistry was performed at 96 h after sh299 vector transfection to examine the HDAC1 protein level. Bovine fibroblast cells of the control group, negative control vector transfection group and sh299 vector transfection group were used as donor cells for nuclear transfer. Cleavage rates and expression of HDAC1 mRNA in bovine cloned embryos were examined at 48 h after nuclear transfer. Blastocyst rates and total cell numbers of blastocysts were examined on Day 7 post-nuclear transfer. Data were analysed with Statistics Production for Service Solution (version 16.0; SPSS) by 1-way ANOVA. A value of P < 0.05 was considered to be significantly different. Our results showed that the expression level of HDAC1 was significantly reduced by transfection of the sh299 expression vector. The GFP-positive cells showed decreased signal for HDAC1 by immunocytochemistry. It was suggested that the transfection of the sh299 expression vector reduced HDAC1 expression in bovine fibroblast cells at both mRNA level and protein level. Following nuclear transfer, expression of HDAC1 was significantly reduced in the sh299 vector transfection group (donor cells were transfected by the sh299 vector) compared to the other 2 groups. No significant difference (P > 0.05) was seen in cleavage rates among bovine cloned embryos in the sh299 vector transfection group (52.3 ± 3.4%), control group (51.1 ± 5.4%) and negative control vector transfection group (56.2 ± 3.1%). However, blastocyst rates and total cell numbers of blastocysts were significantly lower (P < 0.05) in the sh299 vector transfection group (4.2 ± 1.3% and 75.4 ± 9.2, n = 89) compared to the control group (18.2 ± 3.7% and 97.6 ± 7.3, n = 78) and negative control vector transfection group (18.9 ± 1.7% and 104.2 ± 10.3, n = 83). In conclusion, HDAC1 down-regulation in bovine fibroblast cells and cloned embryos by the sh299 expression vector indicated that HDAC1 was essential for the development of bovine cloned embryos. This work was supported by the grant from National Transgenic Animal Program (No.2009ZX08007-004B) in China.

scholarly journals Effects of Synchronization of Donor Cell Cycle on Embryonic Development and DNA Synthesis in Porcine Nuclear Transfer Embryos

2007 ◽  
Vol 53 (2) ◽  
pp. 237-246 ◽  
Author(s):  
Kei MIYAMOTO ◽  
Yoichiro HOSHINO ◽  
Naojiro MINAMI ◽  
Masayasu YAMADA ◽  
Hiroshi IMAI
Keyword(s):  
Cell Cycle ◽  
Embryonic Development ◽  
Dna Synthesis ◽  
Nuclear Transfer ◽  
Donor Cell

scholarly journals 72 EFFECT OF CELL CYCLE PHASE OF GENE-MANIPULATED FETAL FIBROBLASTS ON THE DEVELOPMENT OF CLONED BOVINE EMBRYOS

2005 ◽  
Vol 17 (2) ◽  
pp. 186
Author(s):  
M. Urakawa ◽  
T. Sawada ◽  
Y. Sendai ◽  
Y. Shinkai ◽  
A. Ideta ◽  
...  
Keyword(s):  
Cell Cycle ◽  
Donor Cell ◽  
Developmental Rate ◽  
G1 Phase ◽  
Control Group ◽  
Rate Of Development ◽  
Normal Fetus ◽  
Fetal Fibroblasts ◽  
Blastocyst Rate ◽  
And Control

Transgenic bovine fetuses and offspring can be produced by using gene-modified somatic cells and clones of these cells. In this study, we examined the effects of specific cell cycle (early G1 phase) of donor cell (gene-manipulated fibroblasts) on the development of the nuclear transfer (NT) embryos into blastocysts and on the fetus production after embryo transfer. The gene-manipulated (tg; targeting of one or both alleles of gene encoding α-1,3-galactosyltransferase) or non-manipulated (control) bovine fetal fibroblasts were used for NT. The fibroblasts transfected with the targeting vector were selected with 0.4 mg mL−1 G418. The G418-resistant cells were monitored by PCR and Southern blot analysis. The cells (tg cells) in which homologous recombination occurred were used for NT. For NT, both tg cells and control cells were cultured in DMEM with 10% FCS. Early G1 cells were prepared by choosing pairs of bridged cells derived from mitotic phase cells (Urakawa M et al. 2004 Theriogenology 62, 714–728), and non-synchronized cells were obtained from a culture plate that had reached 60–80% confluence. Each donor cell was inserted into an enucleated, in vitro-matured (19 h) oocyte. Oocyte-cell couples were electrofused and activated with calcium ionophore and cycloheximide. The NT embryos were then co-cultured with bovine oviduct epithelial cells in CR1aa with 5% CS. The blastocyst rates were determined at 6 days after NT. The blastocysts were nonsurgically transferred to recipient heifers, and the developmental rate to the normal fetus was examined by the recovery of fetus or by using ultrasonography at Days 35–42. Data were analyzed by ANOVA. The developmental rate to the blastocyst stage did not differ significantly between tg (28.4%, 128/425) and control (25.4%, 181/739) cell groups. In the control group, the blastocyst rate of embryos constructed from early G1 phase fibroblasts (25.7%, 80/311) was not significantly different from that of embryos constructed with non-synchronized fibroblasts (23.6%, 101/428). In contrast, the blastocyst rate of tg cell derived-embryos was lower (P < 0.05) in early G1 phase (23.5%, 71/302) than in non-synchronized cell phase (46.3%, 57/123). The rate of development to a normal fetus in the tg group (15.4%, 4/26) was significant lower than that in the control group (62.5%, 25/40). For both the tg group and the control group, the rate of development to fetus tended to be higher (P > 0.05) for blastocysts derived from cells at the early G1 phase than for blastocysts derived from non-synchronized cells (tg group, 25.0%, 3/12 v. 7.1%, 1/14; control group, 90.0%, 9/10 v. 53.3%, 16/30). These results demonstrate that gene modification of fetal fibroblasts affects the development of NT embryos to fetuses. In addition, the synchronization of genetically modified donor cells to the early G1 phase may increase the potential to develop to a normal fetus.

scholarly journals CLONAGEM POR TRANSFERÊNCIA NUCLEAR EM BUBALINOS

2017 ◽  
Vol 13 (Especial 2) ◽  
pp. 110-117
Author(s):  
Aline Sousa Camargos ◽  
Ariane Dantas
Keyword(s):  
Gene Expression ◽  
Cell Cycle ◽  
Nuclear Transfer ◽  
Donor Cell ◽  
Somatic Nucleus ◽  
Number Of Species ◽  
Stage Of Development ◽  
Cellular Development

The success of core transfer (CT) depends on the origin of the donor cell, on the stage of development of the recipient cytoplast and on the synchronization between the cell cycle of the donor and recipient cells. The somatic nucleus must be reprogrammed after CT, thus restoring the totipotent state, and then resuming cellular development. However, it is noted that the efficiency of CT is still low, especially with a deficiency of the overall gene expression of the cloned embryo. However, the number of species of cloned mammals has been increasing in the last years, being this technique an important tool that does not aid in the effectiveness of buffalo reproduction. Thus, this review focuses on the description of the main processes pertinent to this process, as well as to analyze as future implications, as well as some factors that affect the success of nuclear transfer.

Sign in / Sign up

Export Citation Format

Share Document