scholarly journals First isolation and molecular phylogenetic analysis of Coxiella burnetii in lactating cows

2021 ◽  
Vol 24 (4) ◽  
pp. 508-519
Author(s):  
H. A. J. Gharban ◽  
A. A. Yousif
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Q Fever ◽  
Age Groups ◽  
Sampling Period ◽  
Rrna Gene ◽  
Pcr Assay ◽  
Milk Samples ◽  
Lactating Cows ◽  
Specific Pathogen

Q fever is an infectious disease of animals and humans, caused by globally distributed C. burnetii. In Iraq, there are no previous studies associated with the detection of the organism in cattle. An overall of 130 lactating cows were submitted to direct collection of milk samples. Initially, the samples of milk were tested using the molecular polymerase chain reaction (PCR) assay targeting three genes (16S rRNA, IS1111a transposase, and htpB). However, positive results (18.46%; 24/130) were detected only with the 16s rRNA gene. Concerning risk factors, the highest prevalence of C. burnetii was showed in the district of Badra (42.86%), whereas the lowest - in Al-Numaniyah and Al-Suwaira districts (P=0.025). There was no significant variation in positivity between the months of sampling period (P=0.082) and between age groups (P=0.076). Crossbred cows (20.69%) showed a higher positivity than local and pure breeds (P=0.043). Milk of positive samples (n=24) was used for cultivation of C. burnetii into specific pathogen free-embryonated chicken eggs (SPF-ECEs). After three passages into SPF-ECEs, contents of yolk sac were collected, subjected for DNA extraction, and re-tested by PCR assay using the primer of 16s rRNA gene only. Of 24 cultivated milk samples, 12.5% (3/24) were positive for C. burnetii. Finally, the positive local isolates were analysed phylogenetically and reported in NCBI-Genbank under the accession numbers of MN121700.1, MN121701.1, and MN121702.1. In conclusion, this is a unique study as it detected C. burnetii in Iraqi lactating cows, and confirmed that organism was shed actively through milk, suggesting that these animals can play a role as a reservoir for organism with potential risk for transmission of infection from these animals to humans as well as to other animal species.

Microbial Diversity in Milk of Women With Mastitis: Potential Role of Coagulase-Negative Staphylococci, Viridans Group Streptococci, and Corynebacteria

2017 ◽  
Vol 33 (2) ◽  
pp. 309-318 ◽  
Author(s):  
Pilar Mediano ◽  
Leonides Fernández ◽  
Esther Jiménez ◽  
Rebeca Arroyo ◽  
Irene Espinosa-Martos ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Microbial Diversity ◽  
Bacterial Species ◽  
Total Bacterial Count ◽  
Rrna Gene ◽  
Coagulase Negative Staphylococci ◽  
Milk Samples ◽  
Lactational Mastitis ◽  
Viridans Group Streptococci

Background: Lactational mastitis constitutes a significant cause of premature weaning. However, its etiology, linked to the presence of pathogenic microorganisms, has been scarcely reported. Research aim: The aim of this study was to describe the microbial diversity in milk samples from women suffering from lactational mastitis and to identify more accurately a collection of isolates belonging to coagulase-negative staphylococci, streptococci, and coryneform bacteria. Methods: This is a cross-sectional descriptive one-group study. A total of 5,009 isolates from 1,849 mastitis milk samples was identified by culture, biochemical, and/or molecular methods at the species or genus level. A more precise identification of a collection of 211 isolates was carried out by 16S rRNA gene sequencing. Results: Mean total bacterial count in milk samples was 4.11 log10 colony-forming units/ml, 95% confidence interval [4.08, 4.15]. Staphylococcus epidermidis was the most common species being isolated from 91.56% of the samples, whereas Staphylococcus aureus was detected in 29.74%. Streptococci and corynebacteria constituted the second (70.20%) and third (16.60%) most prevalent bacterial groups, respectively, found in this study. In contrast, Candida spp. was present in only 0.54% of the samples. Sequencing of the 16S rRNA gene revealed a high diversity of bacterial species among identified isolates. Conclusion: Many coagulase-negative staphylococci, viridans group streptococci, and corynebacteria, usually dismissed as contaminant bacteria, may play an important role as etiologic agents of mastitis. Proper diagnosis of mastitis should be established after performing microbiological testing of milk based on standardized procedures. A reliable analysis must identify the mastitis-causing pathogen(s) at the species level and its(their) concentration(s).

scholarly journals Molecular Detection and Phylogenetic Analysis of Anaplasma Spp. in Cattle in Al-Qadisiyah Province of Iraq

2019 ◽  
Vol 42 (2) ◽  
pp. 181-188
Author(s):  
Hayder N. Ayyez ◽  
Yahia I. Khudhair ◽  
Qassim Haleem Kshash
Keyword(s):  
Phylogenetic Analysis ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Control Strategies ◽  
Age Groups ◽  
Cattle Breed ◽  
16S Rrna Gene Sequencing ◽  
Pcr Analysis ◽  
Rrna Gene ◽  
Rrna Gene Sequencing

AbstractAnaplasma spp. are widely spread rickettsial bacteria transmitted by ticks and placing high impacts on veterinary and public health. A limited number of studies have been carried out on Anaplasmosis in the central part of Iraq. This study was conducted to determine the presence of Anaplasma spp. in cattle in Al-Qadisiyah province, Iraq. A total of 400 blood specimens were collected from cattle suffering from heavy tick infestation. Cattle were blood-sampled from four hyper-endemic areas with ticks. Blood samples were screened using microscopic and polymerase chain reaction (PCR) methods. Diff-quick stained blood smears revealed Anaplasma-like inclusion bodies in 254 (63.5%) samples. According to the 16S rRNA-gene-based PCR analysis, Anaplasma spp. was detected in 124 of the 400 (31%) samples, divided as 96/254 (37.8%) among the microscopical positive samples and 28/146 (19.17%) among the microscopical negative samples. Phylogenetic analysis based on the partial 16S rRNA gene sequencing of ten-PCR positive samples were 99–97% identical to sequences deposited in the GenBank, revealing presence of A. phagocytophilum, A. marginale and unnamed Anaplasma spp. in 40%, 20%, and 40% samples, respectively. Relationships among Anaplasma spp. infections and cattle breed, age, and sex were analyzed. Calves less than one year old showed significantly higher rates (p<0.005) than those from other age groups, whereas sex and breed demonstrated no significant differences (p˃0.001). This study shows that a variety of Anaplasma spp., were endemic in central part of Iraq and is still a hidden problem in cattle in the hyperendemic areas of tick, which requires serious control strategies.

scholarly journals COMPARISON OF DIAGNOSTIC EFFECTIVENESS OF METHODS OF DETECTION OF COXIELLA BURNETII IN BLOOD OF PATIENTS WITH Q FEVER BASED ON AMPLIFICATION OF 16S rRNA GENE FRAGMENTS (STANDARD PCR) AND groEL GENE (REALTIME PCR)

2016 ◽  
pp. 70-74
Author(s):  
Yu. A. Panferova ◽  
O. A. Freilikhman ◽  
N. K. Tokarevich ◽  
S. F. Karpenko ◽  
Kh. M. Galimzyanov
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Coxiella Burnetii ◽  
Q Fever ◽  
Clinical Material ◽  
Rrna Gene ◽  
Gene Fragment ◽  
Rt Pcr ◽  
Pcr Marker ◽  
Infectious Process

Aim. Comparison of diagnostic capabilities of 2 variants of PCR for detection of Coxiella burnetii persistence in dynamics of infectious process in patients with Q fever. Materials and methods. 110 samples of clinical material, obtained from patients with Q fever in an endemic region for this infection (Astrakhan region), were studied. The samples were studied in a standard PCR (marker - 16S rRNA gene fragment) and in real-time PCR (RT-PCR) (marker - groEL gene fragment). Results. Both markers were established to be perspective for detection of C. burnetii DNA in clinical material, and RT-PCR detects positive result including late stages of the disease (illness day 21 - 31). Conclusion. This study is the first Russian publication on comparison on different PCR variants for detection of C. burnetii in blood of Q fever patients in dynamics of the infectious process.

scholarly journals Nested PCR Assay for Detection of Granulocytic Ehrlichiae

1998 ◽  
Vol 36 (4) ◽  
pp. 1090-1095 ◽  
Author(s):  
Robert F. Massung ◽  
Kim Slater ◽  
Jessica H. Owens ◽  
William L. Nicholson ◽  
Thomas N. Mather ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Nested Pcr ◽  
Limit Of Detection ◽  
Rrna Gene ◽  
Pcr Assay ◽  
Serum Samples ◽  
Blood Specimens ◽  
The 16S Rrna Gene ◽  
Edta Blood

A sensitive and specific nested PCR assay was developed for the detection of granulocytic ehrlichiae. The assay amplifies the 16S rRNA gene and was used to examine acute-phase EDTA-blood and serum samples obtained from seven humans with clinical presentations compatible with human granulocytic ehrlichiosis. Five of the seven suspected cases were positive by the PCR assay using DNA extracted from whole blood as the template, compared with a serologic assay that identified only one positive sample. The PCR assay using DNA extracted from the corresponding serum samples as the template identified three positive samples. The sensitivity of the assay on human samples was examined, and the limit of detection was shown to be fewer than 2 copies of the 16S rRNA gene. The application of the assay to nonhuman samples demonstrated products amplified from template DNA extracted fromIxodes scapularis ticks collected in Rhode Island and from EDTA-blood specimens obtained from white-tailed deer in Maryland. All PCR products were sequenced and identified as specific to granulocytic ehrlichiae. A putative variant granulocytic ehrlichia 16S rRNA gene sequence was detected among products amplified from both the ticks and the deer blood specimens.

scholarly journals Haemotropic Mycoplasma Infection Revealed by Real-Time PCR in Specific Pathogen-Free Rats

2014 ◽  
Vol 58 (3) ◽  
pp. 375-378 ◽  
Author(s):  
Hinako Sashida ◽  
Ryô Harasawa ◽  
Toshihiro Ichijo ◽  
Hiroshi Satoh ◽  
Kazuhisa Furuhama
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Real Time ◽  
Real Time Pcr ◽  
Wistar Rat ◽  
Rrna Gene ◽  
Specific Pathogen Free ◽  
Sprague Dawley ◽  
Laboratory Rats ◽  
Specific Pathogen

Abstract The presence of Mycoplasma haemomuris (haemoplasma) in blood samples collected from specific pathogen-free (SPF) laboratory rats bred in Japan was reported. Its presence was examined in Fischer 344, Sprague-Dawley (SD), and Wistar rat strains of both sexes by real-time PCR. All strains were positive for M. haemomuris infection. The 16S rRNA gene of M. haemomuris strain detected in the animals was amplified using end-point PCR. Only the entire nucleotide sequence of 16S rRNA gene of a mycoplasma strain detected in SD rats was determined and compared to those of other haemoplasmas. Our investigations suggest a wide M. haemomuris infection among the SPF rats purchased from commercial breeders in Japan.

A PCR Assay for Detection of Acetic Acid–Tolerant Lactic Acid Bacteria in Acidic Food Products

2004 ◽  
Vol 67 (3) ◽  
pp. 610-615 ◽  
Author(s):  
SHIGERU NAKANO ◽  
ATSUSHI MATSUMURA ◽  
TOSHIHIRO YAMADA
Keyword(s):  
Acetic Acid ◽  
Lactic Acid ◽  
Lactic Acid Bacteria ◽  
16S Rrna ◽  
16S Rrna Gene ◽  
Enrichment Culture ◽  
Rrna Gene ◽  
Bacterial Strains ◽  
Pcr Assay ◽  
Acid Tolerant

A PCR assay for the detection of acetic acid–tolerant lactic acid bacteria in the genera of Lactobacillus and Pediococcus was developed in this study. Primers targeting the bacterial 16S rRNA gene were newly designed and used in this PCR assay. To determine the specificity of the assay, 56 different bacterial strains (of 33 genera), 2 fungi, 3 animals, and 4 plants were tested. Results were positive for most tested bacterial members of 16S rRNA gene–based phylogenetic groups (classi ed in the Lactobacillus casei and Pediococcus group), including Lactobacillus fructivorans, Lactobacillus brevis, Lactobacillus buchneri, Lactobacillus plantarum, and Lactobacillus paracasei. For all other bacterial strains and eukaryote tested, results were negative. Bacterial DNA for PCR was prepared with a simple procedure with the use of Chelex 100 resin from culture after growth in deMan Rogosa Sharpe broth (pH 6.0). To test this PCR assay for the monitoring of the acetic acid–tolerant lactic acid bacteria, L. fructivorans was inoculated into several acidic food as an indicator. Before the PCR, the inoculation of 10 to 50 CFU of bacteria per g of food was followed by a 28-h enrichment culture step, and the PCR assay allowed the detection of bacterial cells. Including the enrichment culture step, the entire PCR detection process can be completed within 30 h.

scholarly journals Real-Time Quantitative Broad-Range PCR Assay for Detection of the 16S rRNA Gene Followed by Sequencing for Species Identification

2006 ◽  
Vol 44 (8) ◽  
pp. 2750-2759 ◽  
Author(s):  
F. Zucol ◽  
R. A. Ammann ◽  
C. Berger ◽  
C. Aebi ◽  
M. Altwegg ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Real Time ◽  
Species Identification ◽  
Rrna Gene ◽  
Pcr Assay ◽  
The 16S Rrna Gene

scholarly journals First Report of Bacterial Leaf Spot of Pumpkin Caused by Xanthomonas cucurbitae in Georgia, United States

Plant Disease ◽  
2013 ◽  
Vol 97 (10) ◽  
pp. 1375-1375 ◽  
Author(s):  
B. Dutta ◽  
R. D. Gitaitis ◽  
F. H. Sanders ◽  
C. Booth ◽  
S. Smith ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Leaf Spot ◽  
Pathogenic Bacteria ◽  
Bacterial Suspension ◽  
Rrna Gene ◽  
Bacterial Isolates ◽  
Pcr Assay ◽  
First Report ◽  
The 16S Rrna Gene

In August 2012, a commercial pumpkin (Cucurbita maxima L. cv. Neon) field in Terrell County, GA, had a disease outbreak that caused severe symptoms on leaves and fruits. Leaves displayed small (2 to 3 mm), angular, water-soaked, yellow lesions while fruits had small (2 to 3 mm), sunken, circular, dry lesions. The field exhibited 40% disease incidence with observable symptoms on fruits. In severe cases, fruit rots were also observed. Symptomatic leaves and fruits were collected from 25 pumpkin plants and isolations were made on both nutrient agar and yeast extract-dextrose-CaCO3 (YDC) agar medium (1). Xanthomonad-like yellow colonies were observed on both agar plates and colonies appeared mucoid on YDC. Suspect bacteria were gram-negative, oxidase positive, hydrolyzed starch and esculin, formed pits on both crystal violet pectate and carboxymethyl cellulose media, but were indole negative and did not produce nitrites from nitrates. Bacterial isolates also produced hypersensitive reactions on tobacco when inoculated with a bacterial suspension of 1 × 108 CFU/ml. Identity of the isolates were identified as genus Xanthomonas by using primers RST2 (5′AGGCCCTGGAAGGTGCCCTGGA3′) and RST3 (5′ATCGCACTGCGTACCGCGCGCGA3′) in a conventional PCR assay, which produced an 840-bp band. The 16S rRNA gene of five isolates was amplified using universal primers fD1 and rD1 (3) and amplified products were sequenced and compared using BLAST in GenBank. The nucleotide sequences (1,200 bp) of the isolates matched Xanthomonas cucurbitae (GenBank Accession AB680438.1), X. campestris (HQ256868.1), X. campestris pv. campestris (NR074936.1), X. hortorum (AB775942.1), and X. campestris pv. raphani (CP002789.1) with 99% similarity. PCR amplification and sequencing of a housekeeping gene atpD (ATP synthase, 720 bp) showed 98% similarity with X. cucurbitae (HM568911.1). Since X. cucurbitae was not listed in the BIOLOG database (Biolog, Hayward, CA), substrate utilization tests for three pumpkin isolates were compared with utilization patterns of Xanthomonas groups using BIOLOG reported by Vauterin et al. (4). The isolates showed 94.7, 93.7, and 92.6% similarity to the reported metabolic profiles of X. campestris, X. cucurbitae, and X. hortorum, respectively, of Xanthomonas groups 15, 8, and 2. However, PCR assay with X. campestris- and X. raphani-specific primers (3) did not amplify the pumpkin isolates, indicating a closer relationship with X. cucurbitae. Spray inoculations of five bacterial isolates in suspensions containing 1 × 108 CFU/ml on 2-week-old pumpkin seedlings (cv. Lumina) (n = five seedlings/isolate/experiment) under greenhouse conditions of 30°C and 70% RH produced typical yellow leaf spot symptoms on 100% of the seedlings. Seedlings (n = 10) spray-inoculated with sterile water were asymptomatic. Reisolated bacterial colonies from symptomatic seedlings displayed similar characteristics to those described above. Further confirmation of bacterial identity was achieved by amplifying and sequencing the 16S rRNA gene, which showed 98 to 99% similarity to X cucurbitae accessions in GenBank. To our knowledge, this is the first report of X. cucurbitae on pumpkin in Georgia. As this bacterium is known to be seedborne, it is possible that the pathogen might have introduced through contaminated seeds. References: (1) N. W. Schaad et al. Laboratory Guide for the Identification of Plant Pathogenic Bacteria, third edition. APS Press. St. Paul, MN, 2001. (2) Y. Besancon et al. Biotechnol. Appl. Biochem. 20:131, 1994. (3) Leu et al. Plant Pathol. Bull. 19:137, 2010. (4) Vauterin et al. Int. J. Syst. Bacteriol. 45:472, 1995.

scholarly journals The first report and biological characteristics of Helcococcus ovis isolated from clinical bovine mastitis in a Chinese dairy herd

2021 ◽  
Author(s):  
Kai Liu ◽  
Zhaoju Deng ◽  
Limei Zhang ◽  
Xiaolong Gu ◽  
Gang Liu ◽  
...  
Keyword(s):  
16S Rrna ◽  
16S Rrna Gene ◽  
Bovine Mastitis ◽  
Infection Model ◽  
Growth Speed ◽  
Rrna Gene ◽  
Biochemical Tests ◽  
Diagnostic Laboratory ◽  
Milk Samples ◽  
Isolation And Characterization

Helcococcus ovis (H. ovis) was first reported in ovine subclinical mastitis milk and post-mortem examinated organs in Spain and the United Kingdom in 1999, subsequently, it appeared in cattle, horse, goat, and human. However, isolation and characterization of the strain in clinical bovine mastitis is unknown. Therefore, our objective was to identify the pathogen in clinical bovine mastitis. A total of 4 strains from 34 bovine mastitis milk samples were identified, there are tiny and transparent colonies from clinical bovine mastitis milk samples in a Chinese dairy farm, however, these colonies could not be identified using on-farm biochemical tests. The isolates were transported to Mastitis Diagnostic Laboratory of China Agricultural University in Beijing. The colonies were identified as a mixture of H. ovis and Arcanobacterium pyogenes according to microscopic examination and 16S rRNA gene sequencing and  the phylogenetic tree was constructed using 16S rRNA gene sequence of H. ovis isolates. In addition, the growth curve and biochemistry test were performed, we also examined the antimicrobial resistance profiles and constructed murine mammary infection model. Our results showed that the H. ovis were closely related to the strains isolated from China and Japan, growth speed of H. ovis was relatively slower than Strep.agalactiae, the phenotypic characteristics were similar to CCUG37441 and CCUG39041 except to lactose, isolates were sensitive to most of antimicrobials except daptomycin, H. ovis could lead to murine mastitis. In this report, we firstly described the characteristics of H. ovis that are associated with clinical bovine mastitis in China.

Sign in / Sign up

Export Citation Format

Share Document