Human Sperm Preparation in ART—Theory and Application

2005 ◽  
Vol 22 (4) ◽  
pp. 211-215 ◽  
Author(s):  
Satoru Kaneko
Keyword(s):  
Human Sperm ◽  
Art Theory ◽  
Sperm Preparation

Effect of sperm preparation on development of bovine blastocyst in vitro

Zygote ◽  
2016 ◽  
Vol 24 (6) ◽  
pp. 825-830 ◽  
Author(s):  
Maria Celina Abraham ◽  
Anders Johannisson ◽  
Jane M. Morrell
Keyword(s):  
Assisted Reproduction ◽  
Membrane Integrity ◽  
Single Layer ◽  
Human Sperm ◽  
Sperm Chromatin ◽  
Computer Assisted ◽  
Cleavage Rate ◽  
Preparation Methods ◽  
Sperm Preparation

SummarySperm preparation is an important step in the in vitro production of embryos. Centrifugation through colloids has been used to select normal sperm for assisted reproduction in several species. Animal models can sometimes be used as a preliminary step to investigate sperm preparation methods that are potentially of use for human fertility treatments. In this study bovine semen was prepared using three variants of the single-layer centrifugation sperm selection technique (Small, Mini, Mini-EP) with Bovicoll (Androcoll-B). Computer-assisted sperm motility analysis, the hypo-osmotic swelling test, and the sperm chromatin structure assay were performed on unselected (control) and SLC-selected sperm samples. Mini and Mini-EP gave the highest yield of motile spermatozoa, progressive motility and membrane integrity. In vitro fertilization trials were performed to investigate the fertilizing ability of the frozen–thawed bovine spermatozoa selected with Bovicoll. Mini-SLC (single-layer centrifugation) and swim-up (Control) were performed and cleavage rate and blastocyst rate did not differ significantly between groups. As there was a trend to an increased number of cells in blastocysts in the SLC group, the Mini-SLC method is at least as good as swim-up for selecting frozen–thawed bull spermatozoa for in vitro fertilization (IVF). This method could potentially be used to prepare human sperm for assisted reproduction.

scholarly journals Sperm Dynein AAA1 and AAA2 Expression in Human Sperm : A Regulation in Sperm Preparation

2018 ◽  
Vol 11 (1) ◽  
pp. 77-84 ◽  
Author(s):  
Silvia W. Lestari ◽  
Manggiasih D. Larasati ◽  
Indra G. Mansur ◽  
Muhammad F. Soelaeman ◽  
Favian A. Rahmat ◽  
...  
Keyword(s):  
Sperm Motility ◽  
Atp Hydrolysis ◽  
Intrauterine Insemination ◽  
Semen Analysis ◽  
Gradient Centrifugation ◽  
Motor Protein ◽  
Human Sperm ◽  
World Health ◽  
Sperm Preparation ◽  
Health Organization

Axoneme structures in sperm tail, is a supramolecular protein complex with motor protein and regulatory which playing a crucial role in determining sperm motility. Dynein, one of the three members of cytoskeletal motor protein, has a ring of six AAA+ which linked together into one large polypeptide that contribute to the formation of sperm flagella bending. The previously research reported that the first two AAA motor domains, AAA1 and AAA2, were a major site in ATP hydrolysis associated with motility in the flagellum. Intrauterine Insemination (IUI) as a management of infertility requires sperm preparation procedures, by Swim-up (SU) and Density Gradient Centrifugation (DGC), in order to enhance the quality regarding concentration and motility of the initial sperm. This study aimed to evaluate the efficiency of the DGC and SU methods in selecting sperm, based the expression of sperm dynein AAA1 and AAA2. Semen samples were obtained from men underwent sperm preparation for IUI and divided into two groups, normozoospermia and asthenozoospermia, according to World Health Organization 2010 guideline. Semen analysis was performed to measure the sperm motility and velocity, before and after sperm preparation. The axoneme was isolated from the obtained samples from SU and DGC methods, while the level of AAA1 and AAA2 was measured by ELISA. This study showed that the percentage of motile sperm and velocity of prepared sperm in both groups in prepared sperm (post-SU and post-DGC) was higher compared to whole semen. The expression of sperm dynein AAA1 of prepared sperm in normozoospermia group showed higher, while in asthenozoospermia group showed lower activities compared to whole semen. The expression of sperm dynein AAA2 of prepared sperm in both groups showed lower activities compared to whole semen. The sperm preparation enhanced the quality of sperm and may increase the expression of sperm dynein AAA1 compared to the whole semen, without the involvement of sperm dynein AAA2.

scholarly journals 195REMOVAL OF EQUINE ARTERITIS VIRUS FROM STALLION SEMEN

2004 ◽  
Vol 16 (2) ◽  
pp. 219
Author(s):  
R.J. GeraghtyE ◽  
J.M. Morrell ◽  
L. Spencer ◽  
P.V. Holmes
Keyword(s):  
Density Gradient ◽  
Natural Infection ◽  
Human Sperm ◽  
Negative Control ◽  
Equine Arteritis Virus ◽  
Preparation Technique ◽  
Sequential Method ◽  
Sperm Preparation ◽  
Nucleocapsid Gene ◽  
Breeding Pool

Infection of breeding horses with equine arteritis virus (EAV) can result in abortion in up to 50% of mares (Del Piero F 2000 Vet. Pathol. 37, 287–296). Viral transmission occurs in body fluids, including semen (Golnik W et al. 1986 Zentralblatt für Veterinarmedizin 33, 413–417), with infected males potentially shedding virus indefinitely. Previously, the only means of preventing EAV transmission via semen was to remove identified shedders from the breeding pool. Recent medical studies have shown that viral infectivity can be removed from the semen of HIV or hepatitis C patients by a sequential method of sperm preparation: i.e. centrifugation on a discontinuous density gradient, followed by swim-up, (e.g. Bujan et al. 2002 Fertil. Steril. 78, 1321–1323; Levy et al. 2002 Hum. Rep. 17, 2650–2653). Human sperm prepared by this method have been used in over 1000 assisted reproduction attempts without sero-conversion of mothers or children (Lyerly A et al. 2001 Fertil. Steril. 75, 843–858). The current study investigates whether a sequential preparation technique of centrifugation on an EquiPure density gradient followed by a swim-up into a sperm maintenance medium can remove EAV from stallion ejaculates. Aliquots (1mL) of stallion semen, extended in Kenny’s medium, were spiked with known quantities of EAV at three levels corresponding to 1.0, 10 and 100 TCID50/mL−1. The latter was considered to be representative of levels seen in natural infection (Timoney PJ et al. 1987 J. Reprod. Fertil. (Suppl. 35), 95–102). Aliquots of spiked semen were prepared by centrifugation on EquiPure gradients. After centrifuging the resulting sperm pellets in EquiSperm Wash, the sperm were subjected to a swim-up treatment (all sperm preparation material from NidaCon, Gothenburg, Sweden). Aliquots of the sperm preparations, the unspiked extended semen, and spiked extended semen were stored at −70°C for viral assay by nested PCR (Belak S et al. 1994 Proc. 7th Int. Conf. Equine Inf. Dis. pp 33–38). The sensitivity of this assay is less than 1 PFU mL−1 of virus in seminal plasma, as validated by Belak et al. Using the PCR technique, a region from the nucleocapsid gene of EAV is amplified, resulting in a 170-base-pair product. Details of the primer sequences used are as follows: first TCGATGGCGTCAAGACGATCAC and GGTTCCTGGGTGGCTAATAACTACTTCAAC; second CGCAACCCACTCAGGCTATTATTG and GGTAGGAACCCAACTGACGGTG. The untreated spiked samples were all positive for EAV, whereas the sperm preparations from the spiked semen, after density gradient and swim-up, were negative for EAV. A negative control (water) and the unspiked extended ejaculate were also negative. These preliminary results indicate that the sequential technique of centrifugation on an EquiPure density gradient followed by a swim-up is potentially a useful and simple tool for the removal of EAV from the semen of shedding stallions. Further experiments will investigate whether the virus can be removed from naturally infected ejaculates. We are grateful to Prof. Twink Allen and Miss Clare Tiplady of the Equine Fertility Unit, Newmarket, UK, for providing samples of stallion semen. This study is partially funded by Eureka (E-2967).

A High Resolution Cytochemical Study of Nuclear ATPase in Human Spermatozoa

1975 ◽  
Vol 33 ◽  
pp. 594-595
Author(s):  
A. Sosa ◽  
L. Calzada
Keyword(s):  
High Resolution ◽  
Atpase Activity ◽  
Nuclear Membrane ◽  
Human Sperm ◽  
Sperm Nucleus ◽  
Human Spermatozoa ◽  
Cytochemical Study ◽  
Membrane Bound ◽  
Sperm Nuclei ◽  
Interchromatin Space

The dependence of nuclear metabolism on the function of the nuclear membrane is not well understood. Whether or not the function of the nuclear membrane is partial or totally responsible of the repressed template activity of human sperm nucleus has not at present been elucidated. One of the membrane-bound enzymatic activities which is concerned with the mechanisms whereby substances are thought to cross cell membranes is adenosintriphosphatase (ATPase). This prompted its characterization and distribution by high resolution photogrammetry on isolated human sperm nuclei. Isolated human spermatozoa nuclei were obtained as previously described. ATPase activity was demonstrated by the method of Wachstein and Meisel modified by Marchesi and Palade. ATPase activity was identified as dense and irregularly distributed granules confined to the internal leaflet of the nuclear membrane. Within the nucleus the appearance of the reaction product occurs as homogenous and dense precipitates in the interchromatin space.

Sign in / Sign up

Export Citation Format

Share Document