scholarly journals Ιοειδή μηλοειδών και πυρηνοκάρπων στην Ελλάδα

2009 ◽  
Author(s):  
Μαρία Καπώνη
Keyword(s):  
Rt Pcr ◽  
Peach Fruit ◽  
Stunt Viroid ◽  
Malus Sylvestris ◽  
Hop Stunt Viroid ◽  
Pyrus Amygdaliformis ◽  
Scar Skin

Αντικείμενο της παρούσης έρευνας αποτελεί η αναλυτική έρευνα των ιοειδών που προσβάλλουν τα μηλοειδή και τα πυρηνόκαρπα στην Ελλάδα (παρουσία, ταυτοποίηση, γεωγραφική εξάπλωση, μοριακός χαρακτηρισμός και φυλογενετικές σχέσεις). Επιβεβαιώθηκαν προηγούμενες αναφορές για την παρουσία στην Ελλάδα των ιοειδών της εσχαρώσεως του φλοιού του μήλου (Apple scar skin viroid, ASSVd) και του εξανθηματικού έλκους της απιδιάς (Pear blister canker viroid, PBCVd) σε μηλοειδή και του νανισμού του λυκίσκου (Hop stunt viroid, HSVd) σε βερυκοκκιά με μοριακό υβριδισμό, RT-PCR, κλωνοποίηση και αλληλούχηση. Η παρούσα εργασία περιλαμβάνει την πρώτη διεθνή καταγραφή του ASSVd σε κερασιά, του HSVd σε μηλιά, άγρια μηλιά και κορομηλιά και του PBCVd σε μηλιά και άγρια μηλιά. Η συχνότητα εμφανίσεως των ASSVd, PBCVd και HSVd, σύμφωνα με τα δεδομένα του μοριακού υβριδισμού σε 1178 δείγματα μηλοειδών και πυρηνοκάρπων, είναι υψηλή (άνω του 30%) σε μηλοειδή (απιδιές, κυδωνιές, μηλιές, αγριομηλιές [Malus sylvestris] και αγριαπιδιές [Pyrus amygdaliformis]) και πυρηνόκαρπα (αμυγδαλιές, αυτοφυείς αμυγδαλιές [Prunus communis], βερυκοκκιές, δαμασκηνιές, κερασιές, κορομηλιές, ροδακινιές) στην Πελοπόννησο (Αργολίδα, Αρκαδία, Αχαΐα και Κορινθία) και την Κεντροδυτική Μακεδονία (Πέλλα, Φλώρινα) και πιο χαμηλή σε Αττική, Ημαθία και Μαγνησία. Επίσης, διαπιστώθηκαν μικτές μολύνσεις 2 ή 3 ιοειδών από τα παραπάνω στις περιπτώσεις 63 δένδρων. Αποκτήθηκαν συνολικά 86 ελληνικές αλληλουχίες ιοειδών: 44 ASSVd, από μηλιά, άγρια μηλιά, απιδιά, αγριαπιδιά και κερασιά, 21 PBCVd, από μηλιά, άγρια μηλιά, απιδιά, αγριαπιδιά και κυδωνιά, και 21 HSVd από μηλιά, άγρια μηλιά, κερασιά, ροδακινιά, βερυκοκκιά, ιαπωνική δαμασκηνιά και κορομηλιά. Σε 2 δένδρα (μηλιά και άγρια μηλιά), αλληλουχήθηκαν πλήρως και τα 3 ιοειδή (ASSVd, PBCVd, HSVd), ενώ σε άλλα 6 (2 μηλιές, 3 απιδιές και 1 άγρια μηλιά) τα ASSVd και PBCVd. Σε 70 πλήρεις αλληλουχίες (42 ASSVd, 16 PBCVd και 12 HSVd) έγινε μοριακός χαρακτηρισμός και φυλογενετική ανάλυση. Οι 42 πλήρεις ελληνικές αλληλουχίες του ASSVd έχουν μεγάλη ομοιότητα (99-100%) με ασιατικές αλληλουχίες από μηλιά και σημαντική παραλλακτικότητα (έως 16%) μεταξύ τους, εφάμιλλη αυτής εντός των κινεζικών. Τρεις ελληνικές παραλλαγές από μηλιά (Πέλλα), άγρια μηλιά (Πέλλα) και απιδιά (Αχαΐα) βρέθηκαν πανομοιότυπες, τόσο μεταξύ τους, όσο και με 3 κινεζικές παραλλαγές από μηλιά. Οι ελληνικές αλληλουχίες εντάσσονται σε 2 ή 3 φυλογενετικά αθροίσματα. Οι περισσότερες ελληνικές αλληλουχίες έχουν ευθύγραμμη δευτεροταγή δομή. Οι 14 από τις 16 πλήρεις ελληνικές αλληλουχίες του PBCVd έχουν μικρή ομοιότητα με αυστραλιανές αλληλουχίες από απιδιά, ασιατική απιδιά και κυδωνιά, και άλλες 2 μεγάλη ομοιότητα (97-98%) με διεθνείς αλληλουχίες από απιδιά. Ταυτόχρονα οι ελληνικές αλληλουχίες έχουν σημαντική παραλλακτικότητα (έως 16%) μεταξύ τους, διπλάσια όλων των υπολοίπων μη ελληνικών αλληλουχιών. Το εγχώριο εύρος ξενιστών του PBCVd περιλαμβάνει 5 είδη μηλοειδών (2 αυτοφυή). Οι ελληνικές αλληλουχίες εντάσσονται σε 2 φυλογενετικά αθροίσματα. Οι περισσότερες ελληνικές αλληλουχίες έχουν διακλαδισμένη δευτεροταγή δομή. Οι 12 πλήρεις ελληνικές αλληλουχίες του HSVd έχουν σημαντική ετερογένεια (έως 17%) μεταξύ τους, ενώ 10 από αυτές φέρουν μια αναδιπλασιασμένη περιοχή 4-10 νουκλεοτιδίων, η οποία δεν έχει βρεθεί σε αλληλουχίες του εξωτερικού. Οι 8 από τις πλήρεις ελληνικές αλληλουχίες ανήκουν στην ομάδα HSVd-P (dapple plum and peach fruit) και έχουν διακλαδισμένη δευτεροταγή δομή. Οι υπόλοιπες 4 ελληνικές αλληλουχίες εντάσσονται στην ομάδα HSVd-H (hop stunt). Η δευτεροταγής δομή των 4 αλληλουχιών είναι ευθύγραμμη, με στοιχεία που παραπέμπουν στην ομάδα HSVd-P. Άλλες 3 ελληνικές αλληλουχίες από βερυκοκκιά, οι οποίες χαρακτηρίστηκαν παλαιότερα, εντάσσονται στην ομάδα HSVdP-H/C3, η οποία προέρχεται από ανασυνδυασμό των προηγούμενων 2 ομάδων, ενώ αλληλουχίες των ομάδων HSVd-P και HSVd-H βρέθηκαν να συνυπάρχουν σε ένα δένδρο άγριας μηλιάς, καθώς και σε 2 γειτονικά δένδρα μηλιάς σε οπωρώνα των Σαρακηνών (Ν. Πέλλας). Αυτά αποτελούν ένδειξη πιθανού τέτοιου ανασυνδυασμού στην Ελλάδα. Η συμπτωματολογία ορισμένων φυτών που φιλοξενούν τις ελληνικές παραλλαγές περιλαμβάνει συμπτώματα σε καρπούς μηλιάς, κορομηλιάς και ροδακινιάς, τα οποία μοιάζουν με εκείνα της ασθένειας dapple plum and peach fruit στην Ιταλία και την Ιαπωνία. Από τη μελέτη αυτή, φαίνεται πως τα ASSVd, PBCVd και HSVd είναι αρκετά διαδεδομένα στην Ελλάδα, στα μηλοειδή και πυρηνόκαρπα και σε άγρια συγγενικά τους είδη. Αυτό το γεγονός, σε συνδυασμό με τη μεγάλη παραλλακτικότητα που βρέθηκε στις ελληνικές αλληλουχίες, αλλά και τις μικτές μολύνσεις, αποτελεί ισχυρή ένδειξη ότι τα ιοειδή αυτά συνυπάρχουν με τα εντόπια άγρια και καλλιεργούμενα είδη φυτών για πολύ μεγάλο χρονικό διάστημα και είναι πιθανώς ιθαγενή στη χώρα μας.

scholarly journals Detection of Multiple Infections of Citrus exocortis viroid, Citrus viroid III, and Hop stunt viroid Variants in Hunan Province, China

Plant Disease ◽  
2007 ◽  
Vol 91 (9) ◽  
pp. 1205-1205 ◽  
Author(s):  
S. Rizza ◽  
A. Catara ◽  
X. F. Ma ◽  
Z. Deng
Keyword(s):  
Polyacrylamide Gel Electrophoresis ◽  
Leaf Roll ◽  
Poncirus Trifoliata ◽  
Hunan Province ◽  
Variable Degree ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Citrus Exocortis Viroid ◽  
Hop Stunt Viroid ◽  
Citrus Viroids

Citrus cultivation in China has increased since the late 1970s, with China now having the largest area of citrus in culture in the world that is spread in 22 provinces and municipalities. Hunan Province has undergone a program to become one of the major citrus producers in China. Poncirus trifoliata is the main rootstock, so citrus viroids are a limiting factor for further citriculture development. In mainland China, only the presence of Citrus exocortis viroid (CEVd) has been reported from Etrog citron indexing, sPAGE (sequential polyacrylamide gel electrophoresis) analysis (2), and reverse transcription (RT)-PCR (3). Three viroid-like RNAs, a1, b1, and d, based on sPAGE patterns were detected years ago in our laboratory in budsticks received from Sichuan Province. To identify different viroids and determine their distribution, a survey has been undertaken. Field trees showing stunting, bark scaling and cracking of the rootstock, and poor yield were tested using biological indexing and PCR for the most frequent citrus viroids. Samples from six trees of a local sweet orange variety and three of a Clementine variety introduced from abroad, both grafted on P. trifoliata and showing a variable degree of bark scaling and cracking, were collected near Changsha and in the County of Xin Ning at the end of summer 2006. Small pieces of bark were inserted in stems of young E. citron budwood grafted on rough lemon and maintained in a warm greenhouse (24 to 32°C). Indexing on E. citron showed mild epinasty and leaf roll typical of citrus viroid infections. To identify specific viroids, bark was ground to a fine powder with liquid nitrogen and total RNA was extracted with TRIZOL Reagent (Invitrogen, San Diego, CA) and tested by RT-PCR to detect CEVd, Hop Stunt viroid (HSVd), and Citrus viroid III (CVd-III), as well as to identify the cachexia variants of HSVd. Four primer pairs were used to test the RNA extracts by RT-PCR (1). All samples were infected by HSVd, eight with CVd-III, and six with CEVd. The cachexia variants of HSVd were detected in four of nine samples. Mixed infections were as follows: one sample had CEVd and HSVd, eight had HSVd and CVd-III, and five were infected by the three viroids. A second sampling 3 months after inoculation gave the same amplification patterns. The results show that at least three viroids are present in citrus orchards in Hunan Province. To our knowledge, this is the first report of cachexia variants of HSVd and CVd-III in China. The common occurrence of these viroids supports the need for proper indexing of mother trees and a specific shoot tip grafting program to create healthy budwood sources to provide healthy plants. References: (1) L. Bernard and N. Duran-Vila. Mol. Cell. Probes, 20:105, 2006. (2) L. Han et al. Viroids. CSIRO Publishing, Melbourne, 283, 2003. (3). Q. Hu et al. Acta Bot. Sin. 39:613, 1997.

scholarly journals First Report of Pear blister canker viroid, Peach latent mosaic viroid, and Hop stunt viroid Infecting Fruit Trees in Tunisia

Plant Disease ◽  
2004 ◽  
Vol 88 (10) ◽  
pp. 1164-1164 ◽  
Author(s):  
I. Fekih Hassen ◽  
J. Kummert ◽  
S. Marbot ◽  
H. Fakhfakh ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Plant Pathogens ◽  
Prunus Persica ◽  
Fruit Trees ◽  
Pcr Analysis ◽  
Economic Damage ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Italian Isolate ◽  
Pear Trees

Viroids of fruit trees are plant pathogens distributed worldwide and can cause severe losses and economic damage to crops. A survey of fruit trees was carried out in 17 orchards in the northern and Sahel regions of Tunisia. Samples were collected in field trees of peach (Prunus persica L), pear (Pyrus communis L), and almond (Prunus dulcis Mill.) that showed symptoms potentially caused by viroids (leaf mosaic in peach, blister canker in pear, and necrotic leaves in almond). The investigation was conducted during May, September, and December 2003 to screen for the presence of Pear blister canker viroid (PBCVd) on pear, Peach latent mosaic viroid (PLMVd) on peach, and Hop stunt viroid (HSVd) on the three plant species in naturally infected field trees. The detection method was based on one-tube reverse transcription-polymerase chain reaction (RT-PCR) assays using a Titan kit (Roche Diagnostics, Penzberg, Germany). DNA amplification was obtained by using previously reported primer pairs for PLMVd and HSVd (1,4). For PBCVd, forward primer 5′ GTCTGAAGCCTGGGCGCTGG 3′ and reverse primer 5′ CCTTCGT CGACGACGAGCCGAG 3′ were designed using an available sequence (3). Positive controls included isolate D168 of PLMVd (obtained from Dr. B. Pradier, Station de Quarantaine des Ligneux, Lempdes, France) and propagated in GF 305 rootstock and HSVd (provided by Dr. R. Flores, Instituto de Biologia Molecular y cellular de Plantas, Valencia, Spain) propagated in cucumber. The method described by Grasseau et al. (2), with some modifications, was used to prepare the samples for RT-PCR. RT-PCR analysis of nucleic acid preparations from leaves and bark of peach, pear, and almond showed that PLMVd occurred in the northern and Sahel regions of Tunisia. Of 37 peach trees tested, 12 were found infected with PLMVd. Two pear trees among 73 tested were infected with PBCVd. HSVd was detected in 2 of 11 almond, 1 of 37 peach, and 7 of 72 pear trees tested. One pear tree infected with HSVd was also infected with PBCVd. Symptoms observed in fruit trees were not consistently associated with the presence of viroids. Nucleotide sequence analyses of cloned amplification products obtained using the PBCVd, PLMVd, and HSVd primers confirmed a size of 315, 330, and 300 nt, respectively, and revealed a sequence similar to sequence variants from other isolates previously characterized for each viroid. PBCVd was 99% identical with the P47A isolate variant 9 (GenBank Accession No. Y18043); PLMVd shared 85 to 96% identity with the PC-C32 Italian isolate of PLMVd from peach (GenBank Accession No. AJ550905), and HSVd shared 99 to 100% identity with the HSVd from dapple plum fruit (GenBank Accession No. AY460202). To our knowledge, our investigation reports for the first time, the occurrence of PLMVd, PBCVd, and HSVd infecting fruit trees in Tunisia, stressing the need for a certification program to aid in prevention and spread of fruit tree viroids in this country. References: (1) N. Astruc. Eur. J. Plant Pathol. 102:837, 1996. (2) N. Grasseau et al. Infos-Ctifl (Centre Technique Interprofessionel des Fruits et Légumes). 143:26,1998. (3) C. Hernandez et al. J. Gen. Virol 73:2503, 1992. (4) S. Loreti et al. EPPO Bull. 29:433, 1999.

scholarly journals Viróides em citros no Estado do Rio de Janeiro

2020 ◽  
Vol 46 (2) ◽  
pp. 121-128
Author(s):  
Jocarstea Aparecida Brinati Leone ◽  
Jorge Ferreira de Souza ◽  
André Felipe Andrade dos Santos ◽  
Paulo Sergio Torres Brioso
Keyword(s):  
Rio De Janeiro ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Citrus Exocortis Viroid ◽  
Hop Stunt Viroid

RESUMO Os viróides infectam plantas de grande importância econômica como os citros. Objetivando detectar a presença de viróides através de métodos moleculares em árvores cítricas, cinco propriedades em Araruama, no Estado do Rio de Janeiro foram avaliadas. Vinte e duas amostras foram coletadas a partir de plantas com nanismo, rachadura no tronco e epinastia, sendo realizada a extração de RNA das folhas e empregado a técnica de RT-PCR com primers específicos para cinco espécies de viróide que infectam citros. O resultado da eletroforese em gel de agarose mostrou-se positivo para os viróides Citrus exocortis viroid (CEVd); Citrus bent leaf viroid (CBLVd); Hop stunt viroid (HSVd) e Citrus dwarfing viroid (CDVd), sendo o último encontrado em todas as propriedades e na combinação com outros viróides, o HSVd e o CBLVd estavam presentes em duas propriedades e o CEVd isoladamente em apenas uma propriedade. Não foi detectada a presença do Citrus viroid IV (CVd-IV) nas amostras avaliadas. Foram observadas diferenças na expressão dos sintomas associados ao CEVd o que pode ter ocorrido devido a interferências entre as espécies de viróides que infectavam uma mesma planta. A transmissão pode ter sido mecanicamente através da poda das plantas cítricas ou através de mudas infectadas com viróide. A utilização de métodos moleculares mostrou-se eficiente na identificação da presença de viróides em plantas cítricas no Estado do Rio de Janeiro.

scholarly journals First Report of Hop stunt viroid in Apricot in China

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 828-828 ◽  
Author(s):  
Y. A. Yang ◽  
H. Q. Wang ◽  
R. Guo ◽  
Z. M. Cheng ◽  
S. F. Li ◽  
...  
Keyword(s):  
Polyacrylamide Gel Electrophoresis ◽  
Rt Pcr ◽  
First Report ◽  
Republic Of China ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Viroid Infection ◽  
Wide Range ◽  
Irregular Border ◽  
Apricot Tree

Hop stunt viroid (HSVd), a member of the family Pospiviroidae, was first described as the causal agent of hop stunt disease in Japan. It has since been found in a wide range of hosts including herbaceous and woody hosts (e.g., hop, cucumber, grapevine, citrus, plum, peach, pear, apricot, almond, and pomegranate). It was also detected and characterized in apricot where infection appears to be latent (1). The viroid occurs frequently in apricot. In southeastern Spain, the presence of HSVd was found to infect 81% of apricot trees (2). Apricots originated in China and are extensively cultivated, but HSVd infection in this host has not been reported. In September 2005, a single symptomatic apricot tree, ‘Yin Bai’, one of the most popular and widely grown cultivars in China, was discovered at the Institute of Fruit Science in Changping District in Beijing, Peoples Republic of China. Observed symptoms included a number of yellow spots with an irregular border that scattered in an irregular manner over the leaf surface. Total RNA was extracted and used for return-polyacrylamide gel electrophoresis and reverse transcription-polymerase chain reaction (RT-PCR) (4). Results of both assays were positive for HSVd. A 297-bp full-length DNA fragment was amplified by RT-PCR using primers R1 (5′-GCTGGATTCTGAGAAGAGTT-3′) complementary to HSVd residues 87–106 for the RT reaction, followed by R2 (5′-AACCCGGGGCTCCTTTCTCA-3′) complementary to HSVd residues 67–84 and forward primer F3 (5′-AACCCGGGGCAACTCTTCTC-3′) residues 79–96 for PCR. The primers are located in the strictly conserved central region of the conserved HSVd group and contain the unique endonuclease restriction site SmaI. The amplified products were cloned into pGEM-T (Promega, Madison, WI) and selected for further analysis on the basis of the results of restriction digests. Six individual clones were sequenced and three different sequences were obtained. Nucleic acid sequence (GenBank Accession No. DQ362901) obtained from one clone was 99.3% (nucleotide changes T206→C, C233→T) identical to HSVd.apr8 (GenBank Accession No. Y09349) (3). Sequence (GenBank Accession No. DQ362904) obtained from three clones was 99.7% (nucleotide change C233→T) and a third sequence (GenBank Accession No. DQ362905) obtained from two clones was 99.3% (nucleotide changes G107→A, C233→T) identical to HSVd.apr8. Further investigation is necessary to determine whether the symptoms observed are associated with the viroid infection. To our knowledge, this is the first report of HSVd isolated from apricot in China. References: (1) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (2) M. C. Cañzres et al. Acta Hortic. 472:581, 1998. (3) S. A. Kofalvi et al. J. Gen. Virol. 78:3177, 1997. (4) S. F. Li et al. Ann. Phytopathol. Soc. Jpn. 61:381, 1995.

scholarly journals Dahlia latent viroid: a recombinant new species of the family Pospiviroidae posing intriguing questions about its origin and classification

2013 ◽  
Vol 94 (4) ◽  
pp. 711-719 ◽  
Author(s):  
Jacobus Th. J. Verhoeven ◽  
Ellis T. M. Meekes ◽  
Johanna W. Roenhorst ◽  
Ricardo Flores ◽  
Pedro Serra
Keyword(s):  
Potato Spindle Tuber Viroid ◽  
Minimum Free Energy ◽  
Rt Pcr ◽  
Stunt Viroid ◽  
Metastable Structures ◽  
Hop Stunt Viroid ◽  
The Family ◽  
Conserved Region ◽  
Characteristic Features ◽  
Maximum Sequence

A viroid-like RNA has been detected in two asymptomatic dahlia accessions by return and double PAGE. It appeared smaller than Chrysanthemum stunt viroid and Potato spindle tuber viroid, the two members of the genus Pospiviroid, family Pospiviroidae, reported in this ornamental previously. RT-PCR with primers designed for amplifying all pospiviroids produced no amplicons, but RT-PCR with random primers revealed a 342 nt RNA. The sequence of this RNA was confirmed with specific primers, which additionally revealed its presence in many dahlia cultivars. The RNA was named Dahlia latent viroid (DLVd) because it replicates autonomously, but symptomlessly, in dahlia and shares maximum sequence identity with other viroids of less than 56 %. Furthermore, DLVd displays characteristic features of the family Pospiviroidae: a predicted rod-like secondary structure of minimum free energy with a central conserved region (CCR), and the ability to form the metastable structures hairpins I and II. Its CCR is identical to that of Hop stunt viroid (HSVd, genus Hostuviroid). However, DLVd: (i) has the terminal conserved region present in members of the genus Pospiviroid, but absent in HSVd, and (ii) lacks the terminal conserved hairpin present in HSVd. Phylogenetic reconstructions indicate that HSVd and Pepper chat fruit viroid (genus Pospiviroid) are the closest relatives of DLVd, but DLVd differs from these viroids in its host range, restricted to dahlia so far. Therefore, while DLVd fulfils the criteria to be a novel species of the family Pospiviroidae, its recombinant origin makes assignment to the genera Pospiviroid or Hostuviroid problematic.

scholarly journals First Report of Hop stunt viroid Infecting Japanese Plum, Cherry Plum, and Peach in Greece

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1662-1662 ◽  
Author(s):  
M. S. Kaponi ◽  
P. E. Kyriakopoulou
Keyword(s):  
Stone Fruit ◽  
Economic Losses ◽  
Prunus Domestica ◽  
Rt Pcr ◽  
Japanese Plum ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Fruit Skin ◽  
Viroid Infection ◽  
Field Samples

Dapple plum and peach fruit is a widely distributed disorder of plum and peach resulting in significant economic losses (4). During a survey for the presence of Hop stunt viroid (HSVd) on stone fruit trees in Greece, samples from 30 European plums (Prunus domestica L., cvs. President, Tuleu Grass), 45 Japanese plums (Prunus salicina Lindl., cvs. Angeleno, Diamond, Santa Rosa), 12 cherry plums (Prunus domestica L. var. insititia (L.) Fiori & Paoletti of unknown cultivar), and 107 peaches (Prunus persica (L.) Batsch, cvs. Red Haven, Elberta, June Gold, Spring Crest, Lemonato) were collected in several orchards around Greece. Their fruit skin symptomatology indicated viroid infection (reddish dappling blotches and cracks in European and Japanese plum, green dappling in cherry plum, and light colored blotches and lines in peach). Samples were screened with tissue-print hybridization (TPH) for HSVd using a full length DIG-labelled riboprobe deriving from in vitro transcription of the positive control, a citrus isolate of HSVd (G. Vidalakis, CCPP, University of California, Riverside). In total, 44 out of the 194 trees surveyed were HSVd-positive with TPH. For a small number (40) of TPH-positive field samples, TNA phenol extraction from fruit skin, leaves, and bark and one-tube two-step reverse transcription (RT)-PCR assays followed, using a standardized protocol (3) with two different primer pairs, one new primer pair (this study) and a previously reported primer pair (2). RT-PCR analysis showed the presence of HSVd in peach and Japanese plum in prefectures Pella (Central Macedonia), Achaia, and Korinthia (Peloponnesus) and in cherry plum in Achaia (Peloponnesus). Six of 11 Japanese plums (cvs. Angeleno, Santa Rosa), 2 of 12 cherry plums, and 8 of 12 peaches (cvs. Spring Crest, Red Haven) examined were found HSVd-infected, but none of the five European plums were. Nucleotide sequence analyses of purified and cloned amplicons from peaches and Japanese and cherry plums revealed sizes of 297 to 308 nt and similarity to sequence variants of other HSVd isolates previously characterized: 95 to 97% identity with the Moroccan isolates apr.9, apr.10, apr.11, and apr.12 and the Spanish isolate apr.4 from apricot (1) (GenBank Accession Nos. AJ297825 to AJ297828 and Y09346, respectively). For confirmation of HSVd presence in field trees, 10 Japanese plums cv. Angeleno, 10 peaches cv. June Gold, and 10 peaches cv. Spring Crest, HSVd-negative (TPH), were bud- or chip-grafted from two of the aforementioned Japanese plums cv. Angeleno and two of the aforementioned peaches cv. Red Haven. Two years later, five Japanese plum trees (cv. Angeleno) and five peach trees (three cv. Spring Crest and two cv. June Gold) were found HSVd-positive with TPH; no fruits were observed to produce fruit symptoms as the grafted trees were kept in an insect-proof greenhouse (no bees for cross-pollination). To our knowledge, our investigation reports for the first time the occurrence of HSVd infecting Japanese plum, cherry plum, and peach in Greece, emphasizing the need for a certification program for the prevention of spreading stone fruit tree viroids in this country. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) N. Astruc et al. Eur. J. Plant Pathol. 102:837, 1996. (3). F. Faggioli et al. Acta. Hort. 550:59, 2001. (4) T. Sano et al. J. Gen. Virol. 70:1311, 1989.

scholarly journals First report of Grapevine yellow speckle viroid 1 infecting grapevine (Vitis vinifera L.) in Canada

Plant Disease ◽  
2021 ◽  
Author(s):  
Dong Xu ◽  
Charith Raj Adkar-Purushothama ◽  
Pierre Lemoyne ◽  
Jean Pierre Perreault ◽  
Mamadou Fall
Keyword(s):  
Rna Extraction ◽  
Leaf Tissue ◽  
Positive Sequence ◽  
Wine Grape ◽  
Library Preparation ◽  
Rt Pcr ◽  
Tissue Samples ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid

Quebec is the third largest wine grape producer in Canada in acreage, tonnage, and wine grape sales (Carisse et al. 2017; Ben Moussa et al. 2019). To evaluate the diversity of viruses infecting grapevine in Quebec, a total of 77 leaf tissue samples (cv. Vidal) were collected from July to October in 2020 in three different vineyards located in Frelighsburg, Hemmingford and Saint-Jacques-le-Mineur in Quebec, Canada. Double-stranded RNA was extracted from each sample and used for cDNA library preparation with the Nextera XT DNA Library Preparation Kit (Illumina) as described previously (Kesanakurti et al. 2016). High-throughput sequencing (HTS, 2x300 bp) was conducted on dual-indexed libraries in a v3 flow cell using the Illumina MiSeq platform (Adkar-Purushothama et al. 2020). The obtained raw FASTQ data was de-multiplexed into 154 separate sequence files, and the adapters and barcode sequences were trimmed. The quality of the sequences was verified using Trimmomatic V.0.32 and the “clean” sequences were analyzed using Virtool and VirFind virus detection pipelines described elsewhere (Ho and Tzanetakis 2014; Rott et al. 2017) to screen for all possible viruses in the databases. Over 100,000 reads per sample were obtained with a percentage of mapped viral reads ranging from 1.47 to 19.43% of total number of reads. Out of 77 samples, 16 revealed the sequence of grapevine yellow speckle viroid 1 (GYSVd-1), for which the length coverage ranged from 98.5 to 99.1%; the depth ranged from 2X to 856X. The GYSVd-1 positive sequence files were subjected to whole genome assembly on CLC genomics Workbench v20.0.4 with the isolate SY-BR from Brazil (KU880715) used as reference. Seven complete genomes of GYSVd-1 of 366-368 nucleotides (nt) in size were deposited (GenBank Acc. MW732682 to MW732688). BLASTN analysis of the sequences showed 98-100% nt identities with isolate SY-BR. Other viruses and viroids such as Grapevine fleck virus, Grapevine rupestris stem pitting-associated virus, Grapevine rupestris vein feathering virus and Hop stunt viroid were also detected. To confirm GYSVd-1 presence in Quebec vineyards, seven of the 16 HTS-positive grapevine leaf tissue samples were subjected to total RNA extraction, followed by RT-PCR assay as before (Adkar-Purushothama et al. 2015; Sahana et al. 2013); all were positive by RT-PCR. The PCR products were directly Sanger-sequenced, and they showed 100% nt identity to the HTS derived sequences. Three of the seven GYSVd-1 positive grapevines exhibited yellow leaf spots and flecks and tiny yellow leaves, but their mixed infection status makes definitive symptoms association difficult to determine. Previously, Hop stunt viroid was reported from grapevines in Canada (Xiao et al. 2019; Fall et al. 2020) but to the best of our knowledge, this is the first report of GYSVd-1 infecting grapevines in Canada, specifically in the province of Quebec. Further research is required to assess the GYSVd-1 related yield loss. Monitoring and testing for GYSVd-1 infection is necessary to prevent propagation of infected materials, spread, and potential negative impact for the Canadian grapevine industry.

scholarly journals First Report of Peach latent mosaic viroid and Hop stunt viroid Infecting Peach Trees in the Czech Republic

Plant Disease ◽  
2003 ◽  
Vol 87 (12) ◽  
pp. 1537-1537 ◽  
Author(s):  
M. Hassan ◽  
P. Rysanek ◽  
F. Di Serio
Keyword(s):  
Czech Republic ◽  
Stone Fruit ◽  
Reference Sequence ◽  
Mixed Infections ◽  
Rt Pcr ◽  
The Czech Republic ◽  
First Report ◽  
Stunt Viroid ◽  
Hop Stunt Viroid ◽  
Peach Trees

Peach latent mosaic viroid (PLMVd) and Hop stunt viroid (HSVd) are known to naturally infect stone fruits, but their contemporary presence in peach trees has been reported only recently (3). During a field validation of detection methods developed for sanitary screening of propagation material, PLMVd and HSVd, alone or in mixed infections, were detected in peach trees grown in the trial orchard of the Czech University of Agriculture in Prague. Leaf samples were collected in September 2002 from symptomless trees of peach cultivars imported from the United States (cvs. Sunhaven, Redhaven, Fairhaven, Cresthaven, Dixired, Halehaven, and NJC 103), Slovakia (cv. Luna), and a tree of Chinese wild peach, Prunus davidiana, and analyzed by reverse transcription-polymerase chain reaction (RT-PCR). PLMVd cDNA was amplified as previously reported (2) or by using two sets of primer pairs designed to amplify partial cDNAs, one reverse primer R: GTTTCTACGG CGGTACCTGA, complementary to the nucleotide positions 204 to 223 and forward primers F1: CGTATCTCAACGCCTCATCA, homologous to the positions 109 to 128, and F2: CTGCAGTTCCCGCTAGAAAG, homologous to the positions 15 to 34 of PLMVd reference sequence (2). The two pairs using the R sequence produced the expected size PCR products of 115 and 209 bp, respectively. RT-PCR for HSVd detection was performed as reported (1). The same total RNA preparations were also analyzed by molecular hybridization with nonisotopic riboprobes specific for each viroid. With minor exceptions, both methods gave similar results. Of 66 tested trees, 5 were infected with PLMVd, 46 were infected with PLMVd and HSVd, and 15 were free of both viroids. Viroid free plants included cvs. Luna, Cresthaven, Dixired, and Halehaven and the species P. davidiana. The high number of infections by both viroids was unexpected because mixed infections are generally rare (3). Most likely, mixed infections occurred during field manipulations and propagation of infected materials. To our knowledge, this is the first report of PLMVd in the Czech Republic. Although further investigations are needed to ascertain the spread of stone fruit viroids in the Czech Republic, our results also report an unusually high incidence of mixed infections of peach trees in this country. These results stress the need for a certification program to help control the spread of stone fruit viroids in the Czech Republic. References: (1) K. Amari et al. J. Gen. Virol. 82:953, 2001. (2) A. M. Shamloul et al. Acta Hort. 386:522, 1995. (3) M. Tessitori et al. Plant Dis. 86:329, 2001.

scholarly journals First Report of Grapevine yellow speckle viroid-1 and Hop stunt viroid Infecting Grapevines (Vitis vinifera) in India

Plant Disease ◽  
2013 ◽  
Vol 97 (11) ◽  
pp. 1517-1517 ◽  
Author(s):  
A. B. Sahana ◽  
C. R. Adkar-Purushothama ◽  
G. Chennappa ◽  
Z. X. Zhang ◽  
M. Y. Sreenivasa ◽  
...  
Keyword(s):  
Sequence Analysis ◽  
Vitis Vinifera ◽  
Northern Blot ◽  
Single Type ◽  
Rt Pcr ◽  
Thompson Seedless ◽  
Stunt Viroid ◽  
Blast Analysis ◽  
Hop Stunt Viroid ◽  
Viroid Infection

During March through July 2012, 10 to 15% of the Vitis vinifera cultivars Thompson Seedless and Anab-e-Shahi exhibited yellow leaf spots and flecks, shortened internodes, and tiny yellow leaves in vineyards of the Bijapur, Doddaballapur, and Kolar districts of Karnataka State, India. These are the major grapevine cultivation regions in India. Samples were collected from four different plants from each district (12 samples in total) and RNA was extracted using 2X CTAB buffer (1). Presence of Grapevine yellow speckle viroid1 (GYSVd-1, genus Apscaviroid) was tested by reverse transcription (RT)-PCR with primer pair PBCVd100C/194H (4) for the amplification of a 220-bp region of the genome. In agarose gel electrophoresis, five samples showed amplicons of the expected size. These amplicons were cloned and sequenced. BLAST analysis confirmed the presence of GYSVd-1. Based on this data, the full-length genome of GYSVd-1 was amplified by RT-PCR using primer pair 341M (5′-CACTCGCGGGGCGCGTTGGA-3′) and 342P (5′-CAATCCCCGGAACCCCCGCT-3′) and the amplicons were cloned and sequenced. Sequence analysis revealed two sequence variants namely Kar-1 (GenBank Accession No. AB742222) and Kar-2 (AB742223) with 98% and 99% identity to GYSVd-1 variants IXc (X87913) and II (X87906), respectively. GYSVd-1 variants Kar-1 and Kar-2 clustered in two distinct phylogenetic sub-clades. All 12 samples also tested positive for Hop stunt viroid (HpSVd, genus Hostuviroid) in two separate sets of RT-PCR using HSV-78P (5′-AACCCGGGGCAACTCTTCTC-3′) and HSV-83M (5′-AACCCGGGGCTCCTTTCTCA-3′); and HSV-7P (5′-AATTCTCGAGTTGCCGC-3′) and HSV-220M (5′-CGAACCGAGAGGTGATGCCA-3′), with the expected size of 303 and 213 bp, respectively (3). Sequence analysis of the amplicons confirmed the presence of HpSVd. Alignment of HpSVd nucleotide sequences obtained from the 12 samples showed the presence of a single type of sequence variant, namely Ind-2 (AB742225). BLAST analysis showed 99% sequence identity of Ind-2 with a HpSVd variant isolated from a 100-year-old grapevine in China. All 12 grapevine samples were also tested for the presence of Australian grapevine viroid (AGVd, genus Apscaviroid), Grapevine yellow speckle viroid 2 (GYSVd 2, genus Apscaviroid), and Citrus exocortis viroid (CEVd, genus Pospiviroid) by RT-PCR as described previously (2). None of the samples showed any positives. Northern blot assay using appropriate digoxigenin-labeled riboprobes performed as described previously (2) further confirmed RT-PCR results. Positive controls for RT-PCR and Northern blot were obtained from viroid-infected grapevines maintained in the greenhouse. GYSVd-1 and HpSVd were detected in symptomatic and symptomless plants. Hence, the symptoms observed in the vineyard cannot be attributed to viroid infection. More work is needed to identify the causal agent(s) of the decline of Thompson Seedless and Anab-e-Shadi cultivars. References: (1) C. R. Adkar-Purushothama et al. Plant Dis. 97:149, 2013. (2) D. Jiang et al. Virus Res, 169:237, 2012. (3) Y. Kawaguchi-Ito et al. PLoS One 4:e8386, 2009. (4) L. I. Ward et al. Plant Dis. 95:617, 2011.

Sign in / Sign up

Export Citation Format

Share Document