Vertebrate osmoregulation: a student laboratory exercise using teleost fish

2007 ◽  
Vol 31 (4) ◽  
pp. 352-357 ◽  
Author(s):  
P. Boily ◽  
B. B. Rees ◽  
L. A. C. Williamson
Keyword(s):  
Teleost Fish ◽  
Mammalian Species ◽  
Plasma Osmolality ◽  
Gill Tissue ◽  
Laboratory Exercise ◽  
Analytical Skills ◽  
Goldfish Carassius Auratus ◽  
Wide Range ◽  
Student Laboratory ◽  
Upper Level

Here, we describe a laboratory experiment as part of an upper-level vertebrate physiology course for biology majors to investigate the physiological response of vertebrates to osmoregulatory challenges. The experiment involves measuring plasma osmolality and Na+-K+-ATPase activity in gill tissue of teleost fish acclimated to water of differing salinity. We describe results obtained using the widely available goldfish ( Carassius auratus) and a common baitfish, the Gulf killifish ( Fundulus grandis). The procedures described are generally applicable to other fish species, and they provide an alternative to the experimental use of humans or other mammalian species to investigate osmoregulation mechanisms. In addition to reenforcing the conceptual material covered in lecture, this laboratory exercise trains students in a wide range of laboratory and analytical skills, such as calculating and performing dilutions, pipetting, tissue sampling and homogenizing, preparing standard curves, conducting enzymatic assays, and analyzing and interpreting results. Typical student results are presented and discussed, as are common experimental and conceptual mistakes made by students.

scholarly journals Exercise- and hypoxia-induced anaerobic metabolism and recovery: a student laboratory exercise using teleost fish

2009 ◽  
Vol 33 (1) ◽  
pp. 72-77 ◽  
Author(s):  
B. B. Rees ◽  
P. Boily ◽  
L. A. C. Williamson
Keyword(s):  
Blood Lactate ◽  
Anaerobic Metabolism ◽  
Normal Values ◽  
Mammalian Species ◽  
Intense Exercise ◽  
Laboratory Exercise ◽  
Hypoxia Exposure ◽  
Subsequent Decrease ◽  
Student Laboratory ◽  
Upper Level

Anaerobic metabolism is recruited in vertebrates under conditions of intense exercise or lowered environmental oxygen availability (hypoxia), typically resulting in the accumulation of lactate in blood and tissues. Lactate will be cleared over time after the reoxygenation of tissues, eventually returning to control levels. Here, we present a laboratory exercise developed as part of an upper-level vertebrate physiology class that demonstrates the effects of exercise and hypoxia exposure on blood lactate in fish and the subsequent decrease in lactate during recovery. Typically, the results obtained by students demonstrate that both treatments cause significant increases in blood lactate concentrations (two to three times higher than control values) that decrease back to normal values within 3 h of recovery under normoxia. The procedures described are generally applicable to other fish species and provide an alternative to using humans or other mammalian species to investigate anaerobic metabolism.

scholarly journals The Molecular Genetics of Red and Green Color Vision in Mammals

Genetics ◽  
1999 ◽  
Vol 153 (2) ◽  
pp. 919-932 ◽  
Author(s):  
Shozo Yokoyama ◽  
F Bernhard Radlwimmer
Keyword(s):  
Amino Acid ◽  
Guinea Pig ◽  
Color Vision ◽  
Molecular Mechanisms ◽  
Mammalian Species ◽  
Columba Livia ◽  
Sciurus Carolinensis ◽  
Green Color ◽  
Goldfish Carassius Auratus ◽  
Wide Range

Abstract To elucidate the molecular mechanisms of red-green color vision in mammals, we have cloned and sequenced the red and green opsin cDNAs of cat (Felis catus), horse (Equus caballus), gray squirrel (Sciurus carolinensis), white-tailed deer (Odocoileus virginianus), and guinea pig (Cavia porcellus). These opsins were expressed in COS1 cells and reconstituted with 11-cis-retinal. The purified visual pigments of the cat, horse, squirrel, deer, and guinea pig have λmax values at 553, 545, 532, 531, and 516 nm, respectively, which are precise to within ±1 nm. We also regenerated the “true” red pigment of goldfish (Carassius auratus), which has a λmax value at 559 ± 4 nm. Multiple linear regression analyses show that S180A, H197Y, Y277F, T285A, and A308S shift the λmax values of the red and green pigments in mammals toward blue by 7, 28, 7, 15, and 16 nm, respectively, and the reverse amino acid changes toward red by the same extents. The additive effects of these amino acid changes fully explain the red-green color vision in a wide range of mammalian species, goldfish, American chameleon (Anolis carolinensis), and pigeon (Columba livia).

scholarly journals Specific expression of an oxytocin-enhanced cyan fluorescent protein fusion transgene in the rat hypothalamus and posterior pituitary

2009 ◽  
Vol 204 (3) ◽  
pp. 275-285 ◽  
Author(s):  
Akiko Katoh ◽  
Hiroaki Fujihara ◽  
Toyoaki Ohbuchi ◽  
Tatsushi Onaka ◽  
W Scott Young ◽  
...  
Keyword(s):  
Fluorescent Protein ◽  
Fusion Gene ◽  
Plasma Osmolality ◽  
Cyan Fluorescent Protein ◽  
Posterior Pituitary ◽  
Protein Fusion ◽  
Transgenic Rats ◽  
Salt Loading ◽  
Wide Range ◽  
Enhanced Cyan Fluorescent Protein

We have generated rats bearing an oxytocin (OXT)-enhanced cyan fluorescent protein (eCFP) fusion transgene designed from a murine construct previously shown to be faithfully expressed in transgenic mice. In situ hybridisation histochemistry revealed that the Oxt–eCfp fusion gene was expressed in the supraoptic nucleus (SON) and the paraventricular nucleus (PVN) in these rats. The fluorescence emanating from eCFP was observed only in the SON, the PVN, the internal layer of the median eminence and the posterior pituitary (PP). In in vitro preparations, freshly dissociated cells from the SON and axon terminals showed clear eCFP fluorescence. Immunohistochemistry for OXT and arginine vasopressin (AVP) revealed that the eCFP fluorescence co-localises with OXT immunofluorescence, but not with AVP immunofluorescence in the SON and the PVN. Although the expression levels of the Oxt–eCfp fusion gene in the SON and the PVN showed a wide range of variations in transgenic rats, eCFP fluorescence was markedly increased in the SON and the PVN, but decreased in the PP after chronic salt loading. The expression of the Oxt gene was significantly increased in the SON and the PVN after chronic salt loading in both non-transgenic and transgenic rats. Compared with wild-type animals, euhydrated and salt-loaded male and female transgenic rats showed no significant differences in plasma osmolality, sodium concentration and OXT and AVP levels, suggesting that the fusion gene expression did not disturb any physiological processes. These results suggest that our new transgenic rats are a valuable new tool to identify OXT-producing neurones and their terminals.

Ecological interactions in the transmission of the leishmaniases

1988 ◽  
Vol 321 (1207) ◽  
pp. 389-404 ◽  
Keyword(s):  
Human Disease ◽  
Mammalian Species ◽  
Epidemiological Studies ◽  
Ecological Interactions ◽  
Environmental Barriers ◽  
Human Host ◽  
Phlebotomine Sandfly ◽  
Ecological Changes ◽  
Wide Range ◽  
Epidemiological Pattern

Epidemiological studies on the leishmaniases are disclosing a multiplicity of Leishmania species infecting a wide range of wild mammalian hosts, from marsupials to monkeys. In the primitive, silvatic habitat these parasites are transmitted by an equally wide variety of phlebotomine sandfly species (Diptera: Psychodidae: Phlebotominae). Transmission is not haphazard, however, and available evidence points to the existence of environmental barriers that normally limit the different Leishmania species to specific sandfly vectors, transmitting to certain mammalian species, within distinct ecotopes. In this situation, humans may become infected by a variety of leishmanial parasites when intruding into the different enzootics, if the sandfly vectors are anthropophilic. Many are not, however, and their parasites rarely, if ever, make contact with the human host. Natural or man-made ecological changes may result in modification of the epidemiological pattern of leishmaniasis, leading to either a reduction or an increase in the human disease.

scholarly journals Traveller exposures to animals: a GeoSentinel analysis

2020 ◽  
Vol 27 (7) ◽  
Author(s):  
Michael P Muehlenbein ◽  
Kristina M Angelo ◽  
Patricia Schlagenhauf ◽  
Lin Chen ◽  
Martin P Grobusch ◽  
...  
Keyword(s):  
Mammalian Species ◽  
Wild Animal ◽  
Post Exposure Prophylaxis ◽  
Behavioral Modification ◽  
Surveillance Network ◽  
Domestic Species ◽  
Wide Range ◽  
Animal Bites ◽  
Exposure Prophylaxis ◽  
Rabies Vaccination

Abstract Background Human coexistence with other animals can result in both intentional and unintentional contact with a variety of mammalian and non-mammalian species. International travellers are at risk for such encounters; travellers risk injury, infection and possibly death from domestic and wild animal bites, scratches, licks and other exposures. The aim of the present analysis was to understand the diversity and distribution of animal-related exposures among international travellers. Methods Data from January 2007 through December 2018 from the GeoSentinel Surveillance Network were reviewed. Records were included if the exposure was non-migration travel with a diagnosis of an animal (dog, cat, monkey, snake or other) bite or other exposure (non-bite); records were excluded if the region of exposure was not ascertainable or if another, unrelated acute diagnosis was reported. Results A total of 6470 animal exposures (bite or non-bite) were included. The majority (71%) occurred in Asia. Travellers to 167 countries had at least one report of an animal bite or non-bite exposure. The majority (76%) involved dogs, monkeys and cats, although a wide range of wild and domestic species were involved. Almost two-thirds (62.6%) of 4395 travellers with information available did not report a pretravel consultation with a healthcare provider. Conclusions Minimizing bites and other animal exposures requires education (particularly during pretravel consultations) and behavioral modification. These should be supplemented by the use of pre-exposure rabies vaccination for travellers to high-risk countries (especially to those with limited access to rabies immunoglobulin), as well as encouragement of timely (in-country) post-exposure prophylaxis for rabies and Macacine alphaherpesvirus 1 (herpesvirus B) when warranted.

scholarly journals A Novel Hepe-Like Virus from Farmed Giant Freshwater Prawn Macrobrachium rosenbergii

Viruses ◽  
2020 ◽  
Vol 12 (3) ◽  
pp. 323 ◽  
Author(s):  
Xuan Dong ◽  
Tao Hu ◽  
Qingyuan Liu ◽  
Chen Li ◽  
Yani Sun ◽  
...  
Keyword(s):  
Hepatitis E Virus ◽  
Phylogenetic Analyses ◽  
Mammalian Species ◽  
Macrobrachium Rosenbergii ◽  
Hepatitis E ◽  
Freshwater Prawn ◽  
Giant Freshwater Prawn ◽  
Wide Range ◽  
The Family ◽  
Virus Genomes

The family Hepeviridae includes several positive-stranded RNA viruses, which infect a wide range of mammalian species, chicken, and trout. However, few hepatitis E viruses (HEVs) have been characterized from invertebrates. In this study, a hepevirus, tentatively named Crustacea hepe-like virus 1 (CHEV1), from the economically important crustacean, the giant freshwater prawn Macrobrachium rosenbergii, was characterized. The complete genome consisted of 7750 nucleotides and had a similar structure to known hepatitis E virus genomes. Phylogenetic analyses suggested it might be a novel hepe-like virus within the family Hepeviridae. To our knowledge, this is the first hepe-like virus characterized from crustaceans.

scholarly journals Feline Model of Acute Nipah Virus Infection and Protection with a Soluble Glycoprotein-Based Subunit Vaccine

2006 ◽  
Vol 80 (24) ◽  
pp. 12293-12302 ◽  
Author(s):  
Bruce A. Mungall ◽  
Deborah Middleton ◽  
Gary Crameri ◽  
John Bingham ◽  
Kim Halpin ◽  
...  
Keyword(s):  
Subunit Vaccine ◽  
Case Reports ◽  
Mammalian Species ◽  
Nipah Virus ◽  
Disease Onset ◽  
Hendra Virus ◽  
Clinical Disease ◽  
Pcr Analysis ◽  
Wide Range ◽  
Feline Model

ABSTRACT Nipah virus (NiV) and Hendra virus (HeV) are paramyxoviruses capable of causing considerable morbidity and mortality in a number of mammalian species, including humans. Case reports from outbreaks and previous challenge experiments have suggested that cats were highly susceptible to NiV infection, responding with a severe respiratory disease and systemic infection. Here we have assessed the cat as a model of experimental NiV infection and use it in the evaluation of a subunit vaccine comprised of soluble G glycoprotein (sG). Two groups of two adult cats each were inoculated subcutaneously with either 500 or 5,000 50% tissue culture infective dose(s) (TCID50) of NiV. Animals were monitored closely for disease onset, and extensive analysis was conducted on samples and tissues taken during infection and at necropsy to determine viral load and tissue tropism. All animals developed clinical disease 6 to 9 days postinfection, a finding consistent with previous observations. In a subsequent experiment, two cats were immunized with HeV sG and two were immunized with NiV sG. Homologous serum neutralizing titers were greater than 1:20,000, and heterologous titers were greater than 1:20,000 to 16-fold lower. Immunized animals and two additional naive controls were then challenged subcutaneously with 500 TCID50 of NiV. Naive animals developed clinical disease 6 to 13 days postinfection, whereas none of the immunized animals showed any sign of disease. TaqMan PCR analysis of samples from naive animals revealed considerable levels of NiV genome in a wide range of tissues, whereas the genome was evident in only two immunized cats in only four samples and well below the limit of accurate detection. These results indicate that the cat provides a consistent model for acute NiV infection and associated pathogenesis and an effective subunit vaccine strategy appears achievable.

359 A NONINVASIVE APPROACH TO DIAGNOSE TRANSGENIC CONCEPTI DURING PREGNANCY IN GOATS

2015 ◽  
Vol 27 (1) ◽  
pp. 268
Author(s):  
K. C. S. Tavares ◽  
C. R. Lazzarotto ◽  
C. M. Calderon ◽  
L. T. Martins ◽  
S. G. Neto ◽  
...  
Keyword(s):  
Mammalian Species ◽  
Proteinase K ◽  
The Road ◽  
Phenol Extraction ◽  
Cell Free Fetal Dna ◽  
Wide Range ◽  
Genetic Features ◽  
Pcr Products ◽  
Dna Precipitation ◽  
Primer Sets

The discovery of cell-free fetal DNA (cffDNA) circulating in the blood of pregnant women, and more recently in cows, ewes, and mares, paves the road towards the development of molecular tools to explore genetic features of embryos and/or fetuses before term. Albeit a wide range of analyses are in current use and development in humans, genetic diagnostic targets other than sex determination are still not described for other mammalian species. The aim of this study was to detect cffDNA from transgenic goat concepti for the human lysozyme (hLZ) gene in the blood of nontransgenic dams. Blood was collected from 3 nontransgenic goats carrying hLZ-transgenic concepti on Days 40–50, 80–90, and 110–120 of gestation. Also, blood was drawn 8 and 12 days after parturition from two other nontransgenic goats that delivered hLZ-transgenic offspring. Blood samples (10 mL) were spun at 1200 rpm for 10 min; resulting serum or plasma were stored at –20°C (serum) or 4°C (plasma). The DNA was extracted by mixing 350 µL of serum or plasma with an equal volume of TE buffer and 5 µL of proteinase K (20 mg mL–1). The mixtures were incubated at 55°C for 3 h, followed by phenol extraction and DNA precipitation by sodium acetate and 100% ethanol, with further incubation at –20°C overnight and centrifugation at 12 000 × g for 10 min. The DNA pellets were washed with 70% ethanol and eluted in 20 µL of ultrapure water. For the PCR, primer sets for the hLZ transgene (hLZ-i1-F 5′ CGGTCCAGGGCAAGGTCTTTGA 3′ and hLZ-i1-R 5′ ACTGCTCCTGGGGTTTTGCC 3′) and for GAPDH as the endogenous control were used. Reactions contained 3 µL of DNA, 200 nM of each primer, and 45 µL of PCR Mastermix (Quatro G Pesquisa & Desenvolvimento, Porto Alegre, Brazil). The DNA from serum and plasma of nontransgenic goats were used as negative controls. The cycling conditions were 95°C for 10 min, followed by 55 cycles of 95°C for 30 s, 58°C for 30 s and 72°C for 30 s, plus a final extension at 72°C for 10 min. The PCR products were analysed by electrophoresis in 2% agarose gel. As expected, GAPDH was amplified in most of the samples (12/13). The 200-bp PCR product corresponding to hLZ was detected in the dam's serum in all 3 gestational phases, with 2 out of 3 animals being positive on 40 to 50 and 80 to 90 days, and all 3 on 110 to 120 days of pregnancy. Furthermore, the transgene was amplified from dam's plasma in all samples after parturition. Only GAPDH amplification was detected in the blood of nontransgenic goats. These results suggest that cffDNA is present in the goat's blood circulation at the fetal phase during pregnancy and at least during the first 2 weeks after parturition. This method can be safely applied as a useful tool in zygote-DNA microinjection experiments, providing an early and preterm diagnostic of transgenic concepti through the dam's blood.Research was supported by FINEP.

Campylobacter coli Naturally Resistant to Elevated Levels of Gentamicin as a Marker Strain in Poultry Research†

2009 ◽  
Vol 72 (6) ◽  
pp. 1288-1292 ◽  
Author(s):  
N. A. COX ◽  
L. J. RICHARDSON ◽  
M. E. BERRANG ◽  
P. J. FEDORKA-CRAY ◽  
R. J. BUHR
Keyword(s):  
Coli Strain ◽  
Blood Agar ◽  
Campylobacter Coli ◽  
Research Projects ◽  
Body Tissues ◽  
Wide Range ◽  
Gentamicin Resistance ◽  
Upper Level ◽  
Suitable Marker ◽  
Poultry Carcass

Campylobacter inoculation studies are limited without a suitable marker strain. The purpose of this study was to screen Campylobacter strains (n = 2,073) obtained from poultry carcass rinses through the Centers for Disease Control and Prevention's National Antimicrobial Resistant Monitoring System for resistance to gentamicin and evaluate one strain's efficacy as a marker. A C. coli strain was found resistant to gentamicin at >32 μg/ml. Gentamicin was incorporated into media (Campy-Cefex agar, Brucella agar, and blood agar) from 0 to 1,000 μg/ml, and the upper level of gentamicin resistance was determined. C. coli strain's upper level of growth on Campy-Cefex plates, blood agar plates, and Brucella agar plates was 400, 300, and 200 μg/ml, respectively. Ceca and postpick carcass rinses were obtained and streaked onto Campy-Cefex agar at the above gentamicin levels to evaluate background microflora exclusion. Campy-Cefex agar containing gentamicin at 100 μg/ml prevented from the ceca, and reduced from the rinse, background microflora. The C. coli strain was orally or intracloacally inoculated into chicks. At 1, 3, and 6 weeks of age, inoculated broilers were removed and several tissue types sampled for the presence of the marker strain. At 6 weeks of age, 10 additional noninoculated penmates were sampled. The C. coli strain colonized chicks, disseminated to body tissues, colonized penmates, and persisted throughout the 6-week grow-out. The C. coli strain's unique characteristic, being resistant to high levels of gentamicin, allows for a marker that can be used in a wide range of Campylobacter research projects.

Sign in / Sign up

Export Citation Format

Share Document