Genetic diversity, reproductive biology, and speciation in the entomopathogenic fungusBeauveria bassiana(Balsamo) Vuillemin

Genome ◽  
2006 ◽  
Vol 49 (5) ◽  
pp. 495-504 ◽  
Author(s):  
K Uma Devi ◽  
A Reineke ◽  
N Nageswara Rao Reddy ◽  
C Uma Maheswara Rao ◽  
J Padmavathi
Keyword(s):  
Beauveria Bassiana ◽  
Species Complex ◽  
Phylogenetic Trees ◽  
Sequence Data ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
Maximum Parsimony Analysis ◽  
Cryptic Speciation ◽  
Nucleotide Sequence Data ◽  
Phylogenetic Lineages

Beauveria bassiana, a mitosporic fungus used for the biological control of many insect species, is recognized as a "species complex" comprising genetically diverse lineages. Being predominantly asexual, mating tests cannot be applied to delimit species in this species complex. Genetic tests offer an indirect means of identifying species among isolates. To this end, molecular genetic analysis of a sample of B. bassiana isolates with 2 subsamples, 1 representing a worldwide collection and another from a localized epizootic population was carried out. DNA markers generated through AFLPs (amplified fragment length polymorphisms) and SSCPs (single-strand conformation poly morphisms) and nucleotide sequence data of different allelic forms of 3 genes (large and small subunits of rRNA and β-tubulin) were evaluated. The B. bassiana isolates from the worldwide sample showed 11% overall similarity and no closely clustered groups. Phylogenetic trees generated from the AFLP and SSCP data of this sample resolved the different isolates into distinct phylogenetic lineages. In the epizootic B. bassiana population, prevalence of recombination was evident from random association of alleles in multilocus tests and lack of phylogenetic concordance among 3 gene genealogies. Thus, the worldwide sample of B. bassiana exhibits a predominantly clonal structure, hinting at species divergence leading to cryptic speciation with recombination being customary among isolates sharing a close ecological niche.Key words: AFLP, asexual entomopathogenic fungus, Beauveria bassiana, clonal lineage/clonality, cryptic speciation, epizootic population, maximum parsimony analysis, multilocus analysis, multiple gene genealogies, recombination, SSCP, worldwide sample.

Molecular insights into the taxonomic status of Coris atlantica (Pisces: Labridae)

2000 ◽  
Vol 80 (5) ◽  
pp. 929-933 ◽  
Author(s):  
Thomas Guillemaud ◽  
Maria L. Cancela ◽  
Pedro Afonso ◽  
Telmo Morato ◽  
Ricardo S. Santos ◽  
...  
Keyword(s):  
Maximum Likelihood ◽  
Phylogenetic Trees ◽  
Sequence Data ◽  
Molecular Genetic ◽  
Taxonomic Status ◽  
Molecular Genetic Analysis ◽  
Maximum Likelihood Analysis ◽  
Rdna Sequence Data ◽  
Likelihood Analysis ◽  
Mitochondrial Rdna

A molecular genetic analysis of Coris julis from different sites in the Mediterranean and the Atlantic and C. atlantica from the Cabo Verde Islands was applied to infer phylogenetic relationships between the taxa. More precisely, partial 12S mitochondrial rDNA sequence data were used in maximum parsimony, neighbour-joining, and maximum likelihood analysis to generate phylogenetic trees. The polymorphism observed indicated an important differentiation between the C. atlantica and C. julis specimens and supported the existence of two different species.

The complete description of larval stages of the lobster shrimpLeonardsaxius amurensis(Kobjakova, 1937) (Decapoda: Axiidea: Axiidae) identified by DNA barcoding

2017 ◽  
Vol 98 (6) ◽  
pp. 1435-1453 ◽  
Author(s):  
Elena S. Kornienko ◽  
Darya D. Golubinskaya ◽  
Olga M. Korn ◽  
Svetlana N. Sharina
Keyword(s):  
Larval Development ◽  
Sequence Data ◽  
Molecular Genetic ◽  
Sympatric Species ◽  
Molecular Genetic Analysis ◽  
Mitochondrial Coi ◽  
Larval Stages ◽  
The Family ◽  
Rdna Sequence Data ◽  
First Time

The complete larval development of the lobster shrimpLeonardsaxius amurensis(Kobjakova, 1937) (Decapoda: Axiidea: Axiidae) is described and illustrated for the first time. The first zoeae of this species were collected from the plankton samples and reared in the laboratory before moulting to the megalopa. A molecular genetic analysis based on comparison of partial mitochondrial COI, 12S rDNA and 16S rDNA sequence data confirmed the identity of axiid larvae found in the plankton andL. amurensisadults collected in the same area. The larval development ofL. amurensisincludes five zoeal stages and a single megalopa. Zoeae I ofL. amurensisare characterized by the presence of one short posterodorsal spine on the fifth pleonite in contrast to the larvae of related sympatric speciesBoasaxius princepshaving four posterodorsal spines on the pleonites 2–5.Leonardsaxius amurensisoccupies an intermediate position between lobster shrimps with abbreviated pelagic development (2–3 zoeal stages) and species with long development (up to eight zoeal stages). Thus, the number of zoeal stages in the family Axiidae varies widely, similarly to that in the families Callianassidae and Upogebiidae.

Morphological and molecular identification of some species of nematode of the family Protostrongylidae Leiper, 1926

2016 ◽  
Vol 3 (4) ◽  
pp. 454-461
Author(s):  
Салахутдинов ◽  
I. Salakhutdinov ◽  
Рузиев ◽  
B. Ruziev ◽  
Каримова ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Phylogenetic Trees ◽  
Molecular Genetic ◽  
Digital Camera ◽  
Molecular Genetic Analysis ◽  
Nucleotide Sequences ◽  
Genetic Identification ◽  
Mountain Area ◽  
Phylogenetic Relations ◽  
The Family

Objective of research: conducting morphological and molecular-genetic identification and studying phylogenetic relations between protostrongylids. Materials and methods: helminthological material was collected from wild (Capra sibirica, C. falconeri, Ovis vignei and O. ammon) and domestic hollow horned ruminants (C. hircus and O. aries), and land mollusks of the family Xeropicta in the piedmont and mountain area of Uzbekisan. The morphology of protostrongylids was studied using the methods of Boev (1975) and Anderson (1978). To identify the nematode type we used temporary preparations treated with glycerol. The first-stage larvae were investigated by examination of fecal samples from animals taking into account the length, tail form and body size. To study the morphology of the third-stage protostrongylid larvae the feet of infected mollusks Xeropicta candaсharica were separated and placed into the artificial gastric juice where the cap was destroyed and the infected larvae were eliminated. After determination of species belonging of mature and larval nematodes the material was stored in separate test-tubes with distilled water under the low temperature (- 20 ºС) or in 70 % Ethanol for the molecular analysis. We used microscopes ML 2000 with a digital camera and Olympus CX3. DNA extraction, amplification and sequencing were performed with an automated sequencer. Phylogenetic analysis was conducted using the software Clustal X 2.0. Phylogenetic trees were created by the Neighbor–Joining method. Nucleotide sequences ITS-2 regions of species Protostrongylus rufescens (EU018485), P. shiozawai (AB478249), Ortostrongylus macrotis (EU018483), Cystocaulus ocreatus (EU018481) and Umingmakstrongylus pallikuukensis (AY648409) received from the NCBI GenBank were used in phylogenetic analysis. Results and discussion: Four species of adult protostrongylid nematodes: Protostrongylus rufescens, P. hobmaieri, Spiculocaulus leuckarti and Cystocaulus ocreatus were determined. DNA from four species of mature protostrongylids and larvae was amplified by using ITS-2 regions. Amplificate dimension of nematodes P. rufescens and P. hobmaieri was 380 base pairs (b.p.), S. leuckarti – 388, C. ocreatus – 399 b.p. According to the results of phylogenetic analysis and comparison of nucleotide sequences, five protostrongylid species were found in animals of the Caprinae subfamily: P. rufescens, P. hobmaieri, Protostrongylus sp., S. leuckarti and C. ocreatus. The morphological and molecular-genetic analysis of detected nematodes enables the precise identification.

scholarly journals CALLIPHORIDAE (REVIEW)

2021 ◽  
pp. 80-84
Author(s):  
Barashkova ◽  
Budishcheva
Keyword(s):  
Ribosomal Rna ◽  
Phylogenetic Trees ◽  
Evolutionary History ◽  
Sequence Data ◽  
28S Rrna ◽  
Cytochrome Oxidase Subunit ◽  
Nucleotide Sequence Data ◽  
The Family ◽  
Gene Coi ◽  
Host Tissues

The Calliphoridae family attracts many researchers in the phylogeny of myiasis in this family. Nevertheless, even after more than 50 years of research of the phylogenetic relationships among Calliphoridae subfamilies, the origin of myiasis remains unclear. By studying the peculiarities of the ecology of blue-green meat flies, and their adaptation to various habitats, it was found that the transition to facultative parasitism at the larval stage could occur in several ways, and was accompanied by the formation of viviparity. The larval parasitism of Calliphoridae on birds developed as a tendency of evolution. Larvae of the genus Protocalliphora, began feeding on blood of birds, and larvae of the species of the genus Trypocalliphora feed on the host tissues causing myiasis and the death of chicks. In order to elucidate the problem, we constructed three phylogenetic trees using nucleotide sequence data from cytochrome oxidase subunit one gene (COI), representing a mitochondrial conservative gene, and nuclear 28S subunit of ribosomal RNA gene (28S rRNA) in order to interpret the evolutionary profile of myiasis in the family Calliphoridae. Comparative analysis of the phylogenetic trees shows that the habit of obligatory myiasis originated independently more than five times among different calliphorid taxa in the course of evolutionary history. The inclusion of other myiasis-causing families (Oestridae, Gastrophilidae, and Sarcophagidae) along with fundamental life-history studies that deal with biology, physiology, feeding behavior and host specificity in addition to phylogenetic analysis could provide a more accurate answer to the origin of myiasis

scholarly journals Confusion surrounding Didymosphaeria—phylogenetic and morphological evidence suggest Didymosphaeriaceae is not a distinct family

Phytotaxa ◽  
2014 ◽  
Vol 176 (1) ◽  
pp. 102 ◽  
Author(s):  
HIRAN A. ARIYAWANSA ◽  
ERIO CAMPORESI ◽  
KASUN M. THAMBUGALA ◽  
AUSANA MAPOOK ◽  
JI-CHUAN KANG ◽  
...  
Keyword(s):  
New Species ◽  
Sequence Data ◽  
Phylogenetic Analyses ◽  
Morphological Characters ◽  
Morphological Evidence ◽  
Nucleotide Sequence Data ◽  
The Family ◽  
Family Based ◽  
Phylogenetic Lineages ◽  
A New Species

Didymosphaeriaceae is a ubiquitous fungal family that is reported to include saprobic, endophytic and pathogenic species associated with a wide variety of substrates. The family is characterized by 1-septate ascospores and trabeculate pseudoparaphyses, mainly anastomosing above the asci. In recent treatments Appendispora, Didymosphaeria, Roussoella, Phaeodothis and Verruculina were placed in the family. The aim of the present study is to delineate phylogenetic lineages within Didymosphaeriaceae and allied genera. A new species, Didymosphaeria rubi-ulmifolii, was isolated and identified based on morphological characters and phylogenetic analyses of partial 18S nrDNA and 28S nrDNA nucleotide sequence data. Didymosphaeria rubi-ulmifolii clustered with Montagnulaceae as a separate genus, while two putative strains (HKUCC 5834 and CMW 22186) of D. futilis from GenBank clustered with Cucurbitariaceae and Didymellaceae, respectively. The new species is characterized by immersed to slightly erumpent ascomata immersed under a clypeus, a peridium with compressed cells of textura intricata, long trabeculate pseudoparaphyses, anastomosing mostly above the asci and brown, 1-septate ascospores with granulate ornamentation. Phylogenetic analysis in combination with morphology and a review of literature show that Appendispora, Phaeodothis, Roussoella and Verruculina should be excluded from the family. Phaeodothis belongs in Montagnulaceae, Verruculina in Testudinaceae, while Appendispora and Roussoella belong in Roussoellaceae. The position of Didymosphaeriaceae as a distinct family, based on 1-septate ascospores and trabeculate pseudoparaphyses, mainly anastomosing above the asci is doubtful. Fresh collections of more Didymosphaeria strains are needed for epitypification and to obtain sequence data to establish if this family can be maintained.

Phylogenetic analysis of the genus Cylicocyclus (Nematoda: Strongylidae) based on nuclear ribosomal sequence data

2013 ◽  
Vol 58 (2) ◽  
Author(s):  
Yanzhen Bu ◽  
Hongxing Niu ◽  
Luping Zhang
Keyword(s):  
Phylogenetic Analysis ◽  
Internal Transcribed Spacer ◽  
Species Complex ◽  
Phylogenetic Trees ◽  
Sequence Data ◽  
Phylogenetic Analyses ◽  
Its Sequences ◽  
Data Sets ◽  
Reference Sequences ◽  
Second Internal Transcribed Spacer

AbstractSeven species of Cylicocyclus Ihle, 1922 (Nematoda: Strongylidae) were collected from donkeys from Henan Province, China. Five samples of each species were selected for sequencing. Sixteen different internal transcribed spacer (ITS) sequences representing the seven species of Cylicocyclus were obtained. Sequence differences in the first internal transcribed spacer (ITS-1) among species was lower than that of the second internal transcribed spacer (ITS-2). Phylogenetic analyses were conducted using the combined ITS-1 and ITS-2 data sets from the present study and using reference sequences from the GenBank database. The MP and ML trees were similar in topology. The phylogenetic trees were divided into two clades. Clade I included 8 species of Cylicocyclus; within this group, Cylicocyclus leptostomus (Kotlan, 1920) is nested between different samples of Cylicocyclus ashworthi (LeRoux, 1924), suggesting C. ashworthi may represent a species complex. Clade II included Cylicocyclus elongatus (Looss, 1900) and Cylicocyclus ultrajectinus (Ihle, 1920); however, these two species always clustered with the comparative species (Petrovinema poculatum (Looss, 1900) and Poteriostomum imparidentatum Quiel, 1919), suggesting that C. elongatus and C. ultrajectinus represent members of other genera.

scholarly journals Use of the method of phylogenetic analysis in an epidemiological investigation in case of HIV infection in pediatric practice

2021 ◽  
Vol 13 (1) ◽  
pp. 106-114
Author(s):  
S. P. Kruglyak ◽  
V. O. Kotova ◽  
E. I. Miroshnichenko ◽  
O. A. Skaly ◽  
E. S. Makhno ◽  
...  
Keyword(s):  
Phylogenetic Analysis ◽  
Nucleotide Sequence ◽  
Hiv Infection ◽  
Phylogenetic Trees ◽  
Comparison Group ◽  
Molecular Genetic ◽  
Molecular Genetic Analysis ◽  
Nucleotide Sequences ◽  
Likelihood Method ◽  
Epidemiological Investigation

The aim of the study is to study the main pathways and risk factors for HIV infection in a child, to establish a probable source of infection for a child, as well as to exclude the possibility of criminal or nosocomial infection.Materials and methods. At the first stage, an epidemiological investigation was conducted. Next, a molecular genetic analysis of two blood plasma samples studied (child and mother) and a comparison group were used, in which 18 nucleotide sequences of HIV-1 variants were used, obtained from patients living in the Primorsky Region, and 8 characterized nucleotide sequences additionally taken from GenBank international database. Distance calculation and phylogenetic analysis were performed by constructing phylogenetic trees using the Maximum Likelihood method using the GTR evolution model.Research results. The data obtained indicate that the nucleotide sequence from the child is most similar to the nucleotide sequence from the mother (potential source) and reliably grouped on the phylogenetic tree, forming a common cluster that is different from the samples of the comparison group. This indicates the likelihood of an epidemiological link between HIV infections in the mother and her child.Conclusion. According to the results of this study, we can conclude that the child is infected from an HIV-infected mother, approximately at the age of a child older than 4 years old, when he received the last negative test result for HIV markers.

scholarly journals SEQUENCE ANALYSIS OF Streptococcus agalactiae, A PATHOGEN CAUSING STREPTOCOCCOSIS IN TILAPIA (Oreochromis niloticus)

2009 ◽  
Vol 4 (2) ◽  
pp. 87 ◽  
Author(s):  
Angela Mariana Lusiastuti ◽  
Taukhid Taukhid ◽  
Eni Kusrini ◽  
Wartono Hadie
Keyword(s):  
Phylogenetic Trees ◽  
Sequence Data ◽  
Pcr Primers ◽  
Biochemical Properties ◽  
Control Fish ◽  
Economic Losses ◽  
Nucleotide Sequence Data ◽  
Prophylactic Measures ◽  
Species Specific ◽  
Time Required

Pathogen identification based on biochemical properties can barely differentiate Streptococcus iniae and S. agalactiae. Beside that, this technique is also limited by the length of time required to complete the assays. Therefore, rapid diagnosis is necessary to initiate prompt therapeutic and prophylactic measures in order to limit any potential economic losses caused by such pathogens. The aim of the present study was to identify Streptococcosis species using amplification of S. agalactiae DNA sequence with species-specific primer Sdi 61 AGGAAACCTGCCATTTGCG and Sdi 252 CAATCTATTTCTAGATCGTGG and perform phylogenetic analysis based on DNA nucleotide sequence data. The sequencing of PCR products was performed at BPPT Puspiptek Serpong by using the respective PCR primers, Big Dye Terminator Chemistry and AmpliTaq-FS DNA polymerase. The sequencing reactions were run on the ABI Prism version 3103 – Avant Genetic Analyzer (USA) and the result was read by Sequence Navigator program (Applied Biosystem). Alignment multiple analysis was done based on the data from Genebank with BLASTN (http://blast.ncbi.nlm.nih.gov/blast.cgi) on the nucleotide level. Neighbor-joining phylogenetic trees were generated with Genetyx programme version 7 with UPGMA and MEGA software version 4.0. The result revealed that the isolates from brain, eye, and kidney of diseased Tilapia were infected by S. agalactiae and it has 99% similarity with Genebank. It has close relationship with S. agalactiae at genebank with UPGMA method. These isolates showed high variation in the first sequence which is similar to S. iniae. The information of S. agalactiae genomes suggests that gene acquisition, duplication, and reassortment have played an important role in genetic diversity and evolution of S. agalactiae. Screening of breeder fish stocks with the developed PCR methodology, followed by elimination of infected stocks, would provide an efficient strategy to control fish infected by streptococcosis.

scholarly journals A new view on the morphology and phylogeny of eugregarines suggested by the evidence from the gregarine Ancora sagittata (Leuckart, 1860) Labbé, 1899 (Apicomplexa: Eugregarinida)

PeerJ ◽  
2017 ◽  
Vol 5 ◽  
pp. e3354 ◽  
Author(s):  
Timur G. Simdyanov ◽  
Laure Guillou ◽  
Andrei Y. Diakin ◽  
Kirill V. Mikhailov ◽  
Joseph Schrével ◽  
...  
Keyword(s):  
Electron Microscopy ◽  
Phylogenetic Trees ◽  
Sequence Data ◽  
Phylogenetic Analyses ◽  
Molecular Data ◽  
Wide Distribution ◽  
Phylogenetic Study ◽  
Molecular Evidence ◽  
Molecular Phylogenetic ◽  
Phylogenetic Lineages

Background Gregarines are a group of early branching Apicomplexa parasitizing invertebrate animals. Despite their wide distribution and relevance to the understanding the phylogenesis of apicomplexans, gregarines remain understudied: light microscopy data are insufficient for classification, and electron microscopy and molecular data are fragmentary and overlap only partially. Methods Scanning and transmission electron microscopy, PCR, DNA cloning and sequencing (Sanger and NGS), molecular phylogenetic analyses using ribosomal RNA genes (18S (SSU), 5.8S, and 28S (LSU) ribosomal DNAs (rDNAs)). Results and Discussion We present the results of an ultrastructural and molecular phylogenetic study on the marine gregarine Ancora sagittata from the polychaete Capitella capitata followed by evolutionary and taxonomic synthesis of the morphological and molecular phylogenetic evidence on eugregarines. The ultrastructure of Ancora sagittata generally corresponds to that of other eugregarines, but reveals some differences in epicytic folds (crests) and attachment apparatus to gregarines in the family Lecudinidae, where Ancora sagittata has been classified. Molecular phylogenetic trees based on SSU (18S) rDNA reveal several robust clades (superfamilies) of eugregarines, including Ancoroidea superfam. nov., which comprises two families (Ancoridae fam. nov. and Polyplicariidae) and branches separately from the Lecudinidae; thus, all representatives of Ancoroidea are here officially removed from the Lecudinidae. Analysis of sequence data also points to possible cryptic species within Ancora sagittata and the inclusion of numerous environmental sequences from anoxic habitats within the Ancoroidea. LSU (28S) rDNA phylogenies, unlike the analysis of SSU rDNA alone, recover a well-supported monophyly of the gregarines involved (eugregarines), although this conclusion is currently limited by sparse taxon sampling and the presence of fast-evolving sequences in some species. Comparative morphological analyses of gregarine teguments and attachment organelles lead us to revise their terminology. The terms “longitudinal folds” and “mucron” are restricted to archigregarines, whereas the terms “epicystic crests” and “epimerite” are proposed to describe the candidate synapomorphies of eugregarines, which, consequently, are considered as a monophyletic group. Abolishing the suborders Aseptata and Septata, incorporating neogregarines into the Eugregarinida, and treating the major molecular phylogenetic lineages of eugregarines as superfamilies appear as the best way of reconciling recent morphological and molecular evidence. Accordingly, the diagnosis of the order Eugregarinida Léger, 1900 is updated.

scholarly journals Genetic Marker Analysis of a Global Collection of Isolates of Citrus tristeza virus: Characterization and Distribution of CTV Genotypes and Association with Symptoms

2005 ◽  
Vol 95 (8) ◽  
pp. 909-917 ◽  
Author(s):  
Mark E. Hilf ◽  
Vessela A. Mavrodieva ◽  
Stephen M. Garnsey
Keyword(s):  
Genetic Marker ◽  
Citrus Tristeza Virus ◽  
Genetic Relatedness ◽  
Sequence Data ◽  
Maximum Parsimony Analysis ◽  
Specific Primers ◽  
Nucleotide Sequence Data ◽  
Disease Symptoms ◽  
Tristeza Virus ◽  
Citrus Tristeza

Genetic markers amplified from three noncontiguous regions by sequence specific primers designed from the partial or complete genome sequences of Citrus tristeza virus (CTV) isolates T3, T30, T36, and VT were used to assess genetic relatedness of 372 isolates in an international collection. Eighty-five isolates were judged similar to the T3 isolate, 81 to T30, 11 to T36, and 89 to VT. Fifty-one isolates were mixed infections by two or more identifiable viral genotypes, and 55 isolates could not be assigned unequivocally to a group defined by marker patterns. Maximum parsimony analysis of aligned marker sequences supported the grouping of isolates on the basis of marker patterns only. Specific disease symptoms induced in select citrus host plants were shared across molecular groups, although symptoms were least severe among isolates grouped by markers with the T30 isolate and were most severe among isolates grouped by markers with the T3 isolate. Isolates assigned the same genotype showed variable symptoms and symptom severity. A classification strategy for CTV isolates is proposed that combines genetic marker patterns and nucleotide sequence data.

Sign in / Sign up

Export Citation Format

Share Document