scholarly journals Effects of elevated substrate–ethylene on colonization of leek (Allium porrum) by the arbuscular mycorrhizal fungus Glomus aggregatum

2002 ◽  
Vol 80 (2) ◽  
pp. 114-119 ◽  
Author(s):  
R D Geil ◽  
F C Guinel
Keyword(s):  
Arbuscular Mycorrhiza ◽  
Hormonal Regulation ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Ethylene Oxidation ◽  
Allium Porrum ◽  
Glomus Aggregatum ◽  
Improved Method ◽  
Ethylene Concentration ◽  
Exogenous Ethylene

There are very few studies of hormonal regulation of arbuscular mycorrhiza formation that include the gaseous hormone ethylene. Ethylene is considered inhibitory to the formation of arbuscular mycorrhizae; however, very low concentrations may promote their formation. We used an improved method of exogenous ethylene application to determine whether ethylene concentration dependent changes in colonization occur in the leek (Allium porrum L. cv. Giant Musselburgh) – Glomus aggregatum Schenck & Smith emend. Koske system. This improved method allowed for a continuous flow of constant concentration of the gas to be applied to a substrate. The 0.6 µL/L substrate–ethylene treatment reduced both root and leaf length and resulted in significantly lower arbuscular colonization compared with controls, whereas the 0.3 µL/L treatment reduced root length only and did not significantly affect colonization levels. Despite continuous application of exogenous ethylene, the amount of ethylene detected in inoculated substrates was reduced to near zero 20 days after inoculation. This decrease may be either due to an increased capacity for ethylene oxidation by arbuscular mycorrhizal roots or because arbuscular mycorrhizal fungi (or other microbes in the pot-cultured inoculum) are capable of metabolizing ethylene. The present study highlights the need for investigations into arbuscular mycorrhizal fungal physiology and the mechanisms by which ethylene regulates arbuscular mycorrhiza formation.Key words: arbuscular mycorrhiza, colonization, exogenous ethylene, monocot.

Frequent cultivation prior to planting to prevent weed competition results in an opportunity for the use of arbuscular mycorrhizal fungus inoculum

2011 ◽  
Vol 27 (4) ◽  
pp. 251-255 ◽  
Author(s):  
David D. Douds ◽  
Gerald Nagahashi ◽  
John E. Shenk
Keyword(s):  
Management Practices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Indigenous Populations ◽  
Paspalum Notatum ◽  
Allium Porrum ◽  
Potential Yield ◽  
Greenhouse Production ◽  
Synthetic Chemicals

AbstractInoculation with arbuscular mycorrhizal (AM) fungi is a potentially useful tool in agricultural systems with limited options regarding use of synthetic chemicals for fertility and pest control. We tested the response ofAllium porrumcv. Lancelot to inoculation with AM fungi in a field high in available P (169 μg g−1soil) that had been repeatedly cultivated to control weeds. Seedlings were inoculated during the greenhouse production period with a mixed species inoculum produced on-farm in a compost and vermiculite medium withPaspalum notatumFlugge as a nurse host. Inoculated and uninoculated seedlings were the same size at outplanting. Inoculated seedlings were over 2.5-fold greater in shoot weight and shoot P content than uninoculated seedlings at harvest. These results demonstrate the potential yield benefits from inoculation with AM fungi in situations where farm management practices may negatively impact on indigenous populations of AM fungi.

scholarly journals Salmonella and Escherichia coli O157:H7 Survival in Soil and Translocation into Leeks (Allium porrum) as Influenced by an Arbuscular Mycorrhizal Fungus (Glomus intraradices)

2013 ◽  
Vol 79 (6) ◽  
pp. 1813-1820 ◽  
Author(s):  
Joshua B. Gurtler ◽  
David D. Douds ◽  
Brian P. Dirks ◽  
Jennifer J. Quinlan ◽  
April M. Nicholson ◽  
...  
Keyword(s):  
Escherichia Coli ◽  
Glomus Intraradices ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
Allium Porrum ◽  
Escherichia Coli O157 ◽  
Content Type ◽  
E Coli ◽  
The Mean

ABSTRACTA study was conducted to determine the influence of arbuscular mycorrhizal (AM) fungi onSalmonellaand enterohemorrhagicEscherichia coliO157:H7 (EHEC) in autoclaved soil and translocation into leek plants. Six-week-old leek plants (with [Myc+] or without [Myc−] AM fungi) were inoculated with composite suspensions ofSalmonellaor EHEC at ca. 8.2 log CFU/plant into soil. Soil, root, and shoot samples were analyzed for pathogens on days 1, 8, 15, and 22 postinoculation. Initial populations (day 1) were ca. 3.1 and 2.1 log CFU/root, ca. 2.0 and 1.5 log CFU/shoot, and ca. 5.5 and 5.1 CFU/g of soil forSalmonellaand EHEC, respectively. Enrichments indicated that at days 8 and 22, only 31% of root samples were positive for EHEC, versus 73% positive forSalmonella. The meanSalmonellalevel in soil was 3.4 log CFU/g at day 22, while EHEC populations dropped to ≤0.75 log CFU/g by day 15. Overall,Salmonellasurvived in a greater number of shoot, root, and soil samples, compared with the survival of EHEC. EHEC was not present in Myc− shoots after day 8 (0/16 samples positive); however, EHEC persisted in higher numbers (P= 0.05) in Myc+ shoots (4/16 positive) at days 15 and 22.Salmonella, likewise, survived in statistically higher numbers of Myc+ shoot samples (8/8) at day 8, compared with survival in Myc− shoots (i.e., only 4/8). These results suggest that AM fungi may potentially enhance the survival ofE. coliO157:H7 andSalmonellain the stems of growing leek plants.

scholarly journals First Report of an Arbuscular Mycorrhizal Fungus Funneliformis mosseae Associated with Thuja plicata in an Ectomycorrhizal Forest in Greece

2016 ◽  
Vol 5 (1) ◽  
pp. 53-53
Author(s):  
Antonios Zambounis ◽  
Aliki Xanthopoulou ◽  
Filippos A. Aravanopoulos ◽  
Athanasios Tsaftaris ◽  
Evaggelos Barbas
Keyword(s):  
Mycorrhizal Fungi ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Am Fungi ◽  
First Record ◽  
Thuja Plicata ◽  
Allium Porrum ◽  
Northern Greece ◽  
Funneliformis Mosseae ◽  
Mycorrhizal Association

The ability of trees forming arbuscular mycorrhizal (AM) associations to get established in ectomycorrhizal forests is still unknown (Weber et al., 2005). The success of both establishment and adaptation depends on the type of interactions between the plants introduced and the type of indigenous soil microbiota (Fahey et al., 2012). Thuja plicata is an AM forest tree successfully established (since 1962) in an artificial trial plantation in the region of Chalkidiki (northern Greece). The successful adaptation of an AM tree in an ectomycorrhizal forest raises questions about the feasibility, if any of the mycorrhizal association under these conditions, as well as on the kind of this association and the species of mycorrhizal fungi putatively involved. During a survey, roots fragments were excised from three Thuja plicata trees and were co-cultured with leek roots (Allium porrum, var. bleu de solaise) in the greenhouse. The successful colonization of the leeks by AM fungi was confirmed by the presence of arbuscular and vesicular structures in the roots after microscopic examination. Colonized Allium porrum roots have then been harvested, surface disinfected (90% ethanol for 10 seconds, 6% sodium hypochlorite for 5 min) and plated on agar solidified medium in Petri dishes. Molecular identification of the mycorrhizal fungal species involved in this symbiosis, was performed after total nucleic acids were extracted using the DNeasy Plant Mini Kit (Qiagen, Crawley, UK). A portion of the 18S ribosomal RNA region was amplified using the primers AML1 (5’ AACTTTCGATGGTAGGATAGA 3’), AML2 (5’ CCAAACACTTTGGTTTCC 3’). The PCR amplicon was cloned using TOPO TA Cloning Kit (Invitrogen, Paisley, U.K.) and sequenced (GenBank accession Nos. KU365383 - KU365385). All partial sequences revealed 99% nucleotide homology with the 18S rRNA sequence of a Funneliformis mosseae fungus isolate (KP144312). To our knowledge, this is the first record of Thuja plicata associated with Glomeromycetes AM fungal communities in an ectomycorrhizal forest in Greece

scholarly journals Response of the Leek (Allium porrum)-Mycorrhizal Fungus Symbiosis to Cutting Levels, Light Exposure and Seedling Density

2021 ◽  
Vol 2 (3) ◽  
pp. 1-6
Author(s):  
G. Nowo Nekou ◽  
A.-M. Sontsa-Donhoung ◽  
. Hawaou ◽  
M. Bahdjolbe ◽  
R. Tobolbaï ◽  
...  
Keyword(s):  
Mycorrhizal Fungi ◽  
Light Exposure ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
The Other ◽  
Allium Porrum ◽  
Seedling Density ◽  
Positive Effects ◽  
Other Hand ◽  
The Impact

This work aims to assess the leek-arbuscular fungus symbiosis response to the effect of cutting and light exposure on the one hand, and the impact of seedling density on this symbiosis on the other hand. Allium Porrum was grown in a container in two different trials. Four species of arbuscular mycorrhizal fungi, Glomus hoi, Scutellospora gregaria, Rhizophagus intraradices and Gigaspora margarita were used to constitute the mycorrhizal inoculum. After 150 days of growth and inoculation, a series of cuts were made on the aerial part (0% = zero cut, 50% = half cut, 100% = whole cut). Plants that had undergone these treatments were placed in shade and sun for 30 days. The leek density per bag was varied by the order of 1, 2, 3 and 4 plant (s) by the pocket density test. Results showed that for 0% of cut in the shade, the vesicle occurrence decreases from 83.33% to 52.22%, and from 90% to 25.5% for 50% of cut in the shade. On the other hand, there is a significant increase in intra-root spores for a complete cut compared to other levels of cuts. For extra-root sporulation, under light, cuts have a negative and weak effect (from -11 to -3%) while in the absence of light, cuts have significant positive effects (from +16 to +61%). Regarding seedling density, the best root colonization (90%) and biomass production (14 g) are obtained with three plants per pot, but it is rather with a density of two plants per pot that extra-root sporulation is higher (153 spores/g). Variation in light, cut level and density significantly affects the development of mycorrhizal fungi.

scholarly journals Effect of Pisolithus tinctorious on Physiological and Hormonal Traits in Cistus Plants to Water Deficit: Relationships among Water Status, Photosynthetic Activity and Plant Quality

Plants ◽  
2021 ◽  
Vol 10 (5) ◽  
pp. 976
Author(s):  
Beatriz Lorente ◽  
Inés Zugasti ◽  
María Jesús Sánchez-Blanco ◽  
Emilio Nicolás ◽  
María Fernanda Ortuño
Keyword(s):  
Water Potential ◽  
Hormonal Regulation ◽  
Defense Mechanisms ◽  
Photosynthetic Activity ◽  
Water Status ◽  
Soil Water Potential ◽  
Mycorrhizal Fungus ◽  
Arbuscular Mycorrhizal ◽  
Root Surface ◽  
Harmful Effects

Cistus species can form ectomycorrhizae and arbuscular mycorrhizal fungus that can bring benefits when plants are under water stress conditions. However, the application of some ectomycorrhizae on the water uptake under drought through physiological traits and hormonal regulation is less known. The experiment was performed during three months in a growth chamber with Cistus albidus plants in which the combined effect of the ectomycorrhiza Pisolithus tinctorious inoculation and two irrigation treatments (control and water-stressed plants) were applied. Irrigation absence caused significant decrease in aerial growth and tended to decrease soil water potential at the root surface, leading to a decrease in leaf water potential. Under these conditions, the abscisic acid and salicylic acid content increased while the precursor of ethylene decreased. Although the mycorrhization percentages were not high, the inoculation of P. tinctorious improved the water status and slightly cushioned the rise in leaf temperature of water-stressed plants. The ectomycorrhiza decreased the scopoletin values in leaves of plants subjected to deficit irrigation, indicating that inoculated plants had been able to synthesize defense mechanisms. Therefore, Pisolithus tinctorious alleviated some of the harmful effects of water scarcity in Cistus plants, being its use a sustainable option in gardening or restoration projects.

Sign in / Sign up

Export Citation Format

Share Document