Tomato yellow leaf curl virus interaction with betasatellites – a global threat to tomato production

2020 ◽  
Vol 69 (7) ◽  
pp. 1191-1192
Author(s):  
Muhammad Shafiq Shahid
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Virus Interaction ◽  
Global Threat ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Use of Tomato yellow leaf curl virus (TYLCV) Rep Gene Sequences to Engineer TYLCV Resistance in Tomato

2004 ◽  
Vol 94 (5) ◽  
pp. 490-496 ◽  
Author(s):  
Y. Yang ◽  
T. A. Sherwood ◽  
C. P. Patte ◽  
E. Hiebert ◽  
J. E. Polston
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Gene Sequences ◽  
Tomato Production ◽  
Challenge Inoculation ◽  
Biolistic Inoculation ◽  
Polymerase Chain ◽  
The Tropics ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the genus Begomovirus (family Geminiviridae), causes severe losses in tomato production in the tropics and subtropics. In order to generate engineered resistance, eight different constructs of the TYLCV replication-associated protein (Rep) and C4 gene sequences were tested in transformed tomato inbred lines. Transgenic plants were screened for resistance to TYLCV using viruliferous whiteflies. No symptoms were observed and no TYLCV genomic DNA was detected by both hybridization and polymerase chain reaction in progenies of plants transformed with three constructs. This resistance was observed in plants that contained one of the following transgenes: 2/5Rep (81 nucleotides [nt] of the intergenic region [IR] plus 426 nt of the 5′ end of the TYLCV Rep gene), Δ2/5Rep (85 nt of the IR plus 595 nt of the 5′ end of the TYLCV Rep gene in the antisense orientation), and RepΔ2/5Rep (81 nt of the IR, the entire Rep gene, and 41 nt 3′ to the end of the Rep gene fused to Δ2/5Rep). Our study differs from other transgenic Geminivirus resistance reports involving the Rep gene in that viruliferous whiteflies were used for challenge inoculation instead of agroinoculation or biolistic inoculation, and TYLCV resistance was evaluated under field conditions.

scholarly journals Determination of the relationship between some morphological traits of the tomato lines and resistance tomato yellow leaf curl virus disease

2019 ◽  
Author(s):  
Sinan Zengin ◽  
Aylin Kabaş ◽  
Hülya İlbi
Keyword(s):  
Morphological Traits ◽  
Virus Disease ◽  
Tomato Yellow Leaf ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Solanum Lycopersicum L ◽  
Biological Tests ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Background: Tomato ( Solanum lycopersicum L.) is the most produced and exported vegetable in Turkey. There are many pathogens to limit tomato production by reducing yield and fruit quality. Among them, Tomato Yellow Leaf Curl Virus (TYLCV) causes important economic losses. The most efficient and environmental friendly method against TYLCV is the use of resistant varieties. In this trial, it was aimed to determine some morphological traits which were linked to Ty-1 and Ty-3a genes which confer to TYLCV. A commercial hybrid carrying Ty-1, Ty-3a genes as heterozygous was crossed to a susceptable inbred line from Bati Akdeniz Agricultural and Research Institute (BATEM). Marker assisted selection (MAS) was carried out in F 1 and F 2 generations and biological tests were done for TYLCV resistance in F 3 generation. MAS for Ty-3a and Ty-1 genes were compatible with biological tests.

scholarly journals Determination of the relationship between some morphological traits of the tomato lines and resistance tomato yellow leaf curl virus disease

2019 ◽  
Author(s):  
Sinan Zengin ◽  
Aylin Kabaş ◽  
Hülya İlbi
Keyword(s):  
Morphological Traits ◽  
Virus Disease ◽  
Fruit Weight ◽  
Tomato Yellow Leaf ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Biological Tests ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Background: Tomato (Solanum lycopersicum L.) is the most produced and exported vegetable in Turkey. There are many pathogens to limit tomato production by reducing yield and fruit quality. Among them, Tomato Yellow Leaf Curl Virus (TYLCV) causes important economic losses. The most efficient and environmental friendly method against TYLCV is the use of resistant varieties. In this trial, it was aimed to determine some morphological traits which were linked to Ty-1 and Ty-3a genes which confer to TYLCV. A commercial hybrid carrying Ty-1, Ty-3a genes as heterozygous was crossed to a susceptible inbred line from Bati Akdeniz Agricultural and Research Institute (BATEM). Marker assisted selection (MAS) was carried out in F1 and F2 generations and biological tests were done for TYLCV resistance in F3 generation. MAS for Ty-3a and Ty-1 genes were compatible with biological tests. Results: In total of 95 genotypes in F3 were developed with molecular marker selection. It was determined that 30 genotypes having the Ty-3a and Ty-1 genes as homozygous resistant. The nine genotypes carried these genes in heterozygous form. 56 genotypes were identified as susceptible. The 43 morphological traits were observed in identified individuals to correlate with resistant allele, Ty-3a. Conclusions: It was found that there was statistically important correlation between Ty-3a and length of internode, length of stem at first inflorescence, status of calix, leaf attitude, length of inflorescence and plant habitus. Also there was negative correlation between fruit weight, fruit length and resistance. Therefore, we identified some morphological markers linked to Ty-3a which can be used in selection for TLYCV resistant breeding programme.

scholarly journals Diverse Regulations of Viral and Host Genes in Tomato Germplasms Responding to Tomato Yellow Leaf Curl Virus Inoculation

2021 ◽  
Author(s):  
Wanyu Xiao ◽  
Xianyu Zhou ◽  
Hailong Ren ◽  
Yijia Sun ◽  
Jiwen Zou ◽  
...  
Keyword(s):  
Resistance Mechanisms ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Virus Inhibition ◽  
Resistant Lines ◽  
Sense Strand ◽  
Virion Sense ◽  
Leaf Curl Virus ◽  
Leaf Curl

Abstract Tomato yellow leaf curl virus (TYLCV) is the dominating pathogen of tomato yellow leaf curl disease that caused severe loss to tomato production in China. In this study, we found that a TYLCV-resistant tomato line drastically reduced the accumulation of viral complementary-sense strand mRNAs but just moderately inhibit that of viral DNA and virion-sense strand mRNAs. However, two other resistant lines did not have such virus inhibition pattern. Analysis of differential expressed genes showed that the potential host defense-relevant processes varied in different resistant tomatoes, as compared to the susceptible line, suggesting a diversity of tomato TYLCV-resistance mechanisms.

scholarly journals The recent association of a DNA betasatellite with Tomato yellow leaf curl virus in Israel – A new threat to tomato production

2020 ◽  
Vol 128 ◽  
pp. 104995 ◽  
Author(s):  
Dana Gelbart ◽  
Lea Chen ◽  
Tamar Alon ◽  
Svetlana Dobrinin ◽  
Ilan Levin ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1017-1017 ◽  
Author(s):  
G. Anfoka ◽  
F. Haj Ahmad ◽  
M. Altaleb ◽  
M. Al Shhab
Keyword(s):  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Single Infection ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Tomato Plants ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Pepper Plants in Cuba

Plant Disease ◽  
2002 ◽  
Vol 86 (1) ◽  
pp. 73-73 ◽  
Author(s):  
M. Quiñones ◽  
D. Fonseca ◽  
Y. Martinez ◽  
G. P. Accotto
Keyword(s):  
Field Survey ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Chain Reaction ◽  
Tomato Production ◽  
First Report ◽  
Polymerase Chain ◽  
Leaf Curl Virus ◽  
Pepper Plants ◽  
Leaf Curl

The begomovirus Tomato yellow leaf curl virus (TYLCV) is one of the major threats to tomato production in tropical and subtropical regions worldwide. TYLCV was found in Cuba in 1994 and later became the most serious constraint to tomato production (2). During a field survey in 2001, pepper plants (Capsicum annuum) were observed in a greenhouse in Camagüey Province, showing mild interveinal yellowing and curling of leaves. Total nucleic acids were extracted from these plants and from pepper samples collected in previous years that showed similar symptoms. Polymerase chain reaction (PCR) was performed on extracts using a primer pair (TY-1/TY-2) (1) specific for the capsid protein (CP) gene of begomoviruses and a second primer pair (IR2353+: CTGAATGTTTGGATGGAAATGTGC; IR255-:GCTCGTAAGTTTCCT CAACGGAC) designed to amplify the part of the genome encompassing the intergenic region (IR) of the Cuban isolate of TYLCV-IS (2). With these primer pairs, amplicons of the expected size were obtained from five samples (one collected in 1995 in Havana Province, two in 1999 in Sancti Spiritus, and two in 2001 in Camagüey.) The CP fragment was digested with RsaI, while the IR amplicon was digested with AvaII and EcoRI. In all cases the patterns obtained corresponded to digestion patterns for identical PCR fragments obtained from TYLCV-infected tomatoes. The IR amplicon sequence from one sample showed ≈99% identity with the corresponding region of the TYLCV-IS isolated from tomato in Cuba. To our knowledge, this is the first report of TYLCV-IS infection in peppers in Cuba. References: (1) G. P. Accotto et al. Eur. J. Plant. Pathol. 106:179, 2000. (2) Y. Martínez et al. J. Phytopathol.144:277, 1996.

scholarly journals Spatial and Temporal Physiognomies of Whitefly and Tomato Yellow Leaf Curl Virus Epidemics in Southwestern Florida Tomato Fields

2020 ◽  
Vol 110 (1) ◽  
pp. 130-145 ◽  
Author(s):  
Daniel J. Anco ◽  
Lisa Rouse ◽  
Leon Lucas ◽  
Felicia Parks ◽  
H. Charles Mellinger ◽  
...  
Keyword(s):  
Regional Scale ◽  
Tomato Yellow Leaf ◽  
Moran’S I ◽  
Weather Data ◽  
Yellow Leaf ◽  
Moran's I ◽  
Tomato Production ◽  
Daily Weather Data ◽  
Leaf Curl Virus ◽  
Leaf Curl

Epidemics of tomato yellow leaf curl virus (TYLCV; species Tomato yellow leaf curl begomovirus) have been problematic to tomato production in the southeastern United States since the first detection of the virus in Florida in the late 1990s. Current strategies for management focus on farm-centric tactics that have had limited success for controlling either TYLCV or its whitefly vector. Areawide pest management (AWPM)—loosely defined as a coordinated effort to implement management strategies on a regional scale—may be a viable management alternative. A prerequisite for development of an AWPM program is an understanding of the spatial and temporal dynamics of the target pathogen and pest populations. The objective of this study was to characterize populations of whitefly and TYLCV in commercial tomato production fields in southwestern Florida and utilize this information to develop predictors of whitefly density and TYLCV disease incidence as a function of environmental and geographical factors. Scouting reports were submitted by cooperating growers located across approximately 20,000 acres in southwestern Florida from 2006 to 2012. Daily weather data were obtained from several local weather stations. Moran’s I was used to assess spatial relationships and polynomial distributed lag regression was used to determine the relationship between weather variables, whitefly, and TYLCV. Analyses showed that the incidence of TYLCV increased proportionally with mean whitefly density as the season progressed. Nearest-neighbor analyses showed a strong linear relationship between the logarithms of whitefly densities in neighboring fields. A similar relationship was found with TYLCV incidences. Correlograms based on Moran’s I showed that these relationships extended beyond neighboring fields and out to approximately 2.5 km for TYLCV and up to 5 km for whitefly, and that values of I were generally higher during the latter half of the production season for TYLCV. Weather was better at predicting whitefly density than at predicting TYLCV incidence. Whitefly density was best predicted by the number of days with an average temperature between 16 and 24°C (T16to24), relative humidity (RH) over the previous 31 days, and vapor pressure deficit over the last 8 days. TYLCV incidence was best predicted by T16to24, RH, and maximum wind speed over the previous 31 days. Results of this study helped to identify the extent to which populations of whitefly and TYLCV exist over the agricultural landscape of southwestern Florida, and the environmental conditions that favor epidemic growth. This information was used to propose an approach to AWPM for timing control measures for managing TYLCV epidemics.

scholarly journals Identification of Weed Hosts of Tomato yellow leaf curl virus in Cyprus

Plant Disease ◽  
2011 ◽  
Vol 95 (2) ◽  
pp. 120-125 ◽  
Author(s):  
L. C. Papayiannis ◽  
N. I. Katis ◽  
A. M. Idris ◽  
J. K. Brown
Keyword(s):  
Real Time ◽  
Management Strategies ◽  
Extensive Study ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Weed Species ◽  
Pcr Assay ◽  
Tomato Production ◽  
Leaf Curl Virus ◽  
Leaf Curl

An extensive study was conducted during 2007 and 2008 in three major tomato production areas of Cyprus, where Tomato yellow leaf curl virus (TYLCV) is commonly found, to assess the incidence and prevalence of naturally infected weed species that could serve as TYLCV reservoirs. Approximately 4,000 of the most common dicotyledonous plants belonging to 122 species from 25 families were collected, identified, and tested for TYLCV presence using serological and molecular methods. The tests included a previously reported conventional polymerase chain reaction (PCR) assay and a real-time TaqMan PCR assay developed and optimized in this study. Real-time PCR was found to be the most sensitive technique, and enabled the detection of TYLCV in 461 samples of 49 different species belonging to the families Amaranthaceae, Chenopodiaceae, Compositae, Convolvulaceae, Cruciferae, Euphorbiaceae, Geraniaceae, Leguminosae, Malvaceae, Orobanchaceae, Plantaginaceae, Primulaceae, Solanaceae, Umbelliferae, and Urticaceae. The results further indicated that the host range of TYLCV in Cyprus is far more extensive than previously documented and, therefore, new management strategies are required. These should focus on the control of alternative virus hosts during the growing season and in crop-free periods.

scholarly journals Current Status and New Natural Hosts of Tomato yellow leaf curl virus (TYLCV) in Spain

Plant Disease ◽  
2001 ◽  
Vol 85 (4) ◽  
pp. 445-445 ◽  
Author(s):  
C. Jordá ◽  
I. Font ◽  
P. Martínez ◽  
M. Juarez ◽  
A. Ortega ◽  
...  
Keyword(s):  
Canary Islands ◽  
Tomato Yellow Leaf ◽  
Current Status ◽  
Economic Losses ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Chenopodium Murale ◽  
Natural Hosts ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a major constraint to tomato production in Spain. This virus was observed for the first time in several tomato fields in Murcia (Spain) in the autumn of 1992 and Canary Islands in 1999. Currently the virus is prevalent along the Mediterranean coast of Spain (provinces of Málaga, Granada, Almería, Murcia, Alicante, Valencia, and Barcelona) and in the Canary Islands. Two viral species have been identified in Spain, TYLCV-Sar in 1992 and TYLCV-Is in 1997. TYLCV-Is is more severe than TYLCV-Sar and produces the greatest economic losses. Curling of leaflets, yellowing, and growth reduction are more pronounced in plants infected with TYLCV-Is than in those infected with TYLCV-Sar. In order to study the presence and behavior of both viral species in the affected area, over 1,320 tomato plants were sampled. DNA was extracted from the samples and analyzed by polymerase chain reaction (PCR) amplification. The degenerate primer pair for Begomovirus detection (AV494/AC1048) (2) was used to amplify the core region of the capsid protein gene. The amplified fragments were later analysed by restriction fragment length polymorphism (RFLP) with HaeIII enzyme to differentiate between TYLCV-Is and TYLCV-Sar species. The results showed that TYLCV-Sar (43.4%) and TYLCV-Is (56.6%) coexist in tomato crops and, in contrast with previous results (1), displacement of TYLCV-Sar for TYLCV-Is was observed. A search for the alternative hosts that may serve as virus reservoirs in areas where the virus is prevalent involved testing 210 samples of 95 species of weeds by PCR, with the same primers. The following species were found to be infected: Conyza sumatrensis (Retz.) E. Walker, Convolvulus sp., Cuscuta sp., Chenopodium murale L., Datura stramonium L., Dittrichia viscosa (L.) W. Greuter, Malva parviflora L., and Solanum nigrum L. This is the first reference of C. sumatrensis, Convolvulus sp., Cuscuta sp., and Ch. murale as natural hosts of TYLCV. These plants were symptomless. References: (1) S. Sanchez-Campos et al. Phytopathology 89:1038, 1999. (2) S. D. Wyatt et al. Phytopathology 86:1288, 1996.

Sign in / Sign up

Export Citation Format

Share Document