Carrot mottle virus ORF4 movement protein targets plasmodesmata by interacting with the host cell SUMOylation system

Abstract A new distribution map is provided for Carrot mottle virus. Virus: Umbravirus. Hosts: carrot (Daucus carota); parsley (Petroselinum crispum), cow parsley (Anthriscus sylvestris) and other wild hosts. Information is given on the geographical distribution in Europe (Belgium, Denmark, France, Germany, the Netherlands, UK, England and Wales, Scotland), Asia (Japan), Africa (Morocco), North America (Canada, British Columbia, USA, California, Pennsylvania, Washington, Wisconsin), South America (Brazil, Minas Gerais, Sao Paulo), Oceania (Australia, New South Wales, South Australia, Tasmania, Victoria, Western Australia, New Zealand).

Download Full-text

Complete nucleotide sequence of a carrot isolate of Carrot mottle virus from Germany

Archives of Virology ◽

10.1007/s00705-008-0223-6 ◽

2008 ◽

Vol 153 (11) ◽

pp. 2163-2165 ◽

Cited By ~ 2

Author(s):

W. Menzel ◽

E. Maiss ◽

H. J. Vetten

Keyword(s):

Nucleotide Sequence ◽

Complete Nucleotide Sequence ◽

Mottle Virus ◽

Carrot Mottle Virus

Download Full-text

In Vitro: Natural Compounds (Thymol, Carvacrol, Hesperidine, And Thymoquinone) Against Sars-Cov2 Strain Isolated From Egyptian Patients

10.21203/rs.3.rs-119568/v1 ◽

2020 ◽

Author(s):

Mohamed G Seadawy ◽

Ahmed F. Gad ◽

Mohamed Shamel ◽

Bassem Elharty ◽

Mostfa F. Mohamed ◽

...

Keyword(s):

Host Cell ◽

Natural Compounds ◽

Cell Protein ◽

Protein Targets ◽

Plaque Reduction Assay ◽

Main Protease ◽

Immunodeficiency Virus ◽

Egyptian Patients ◽

Clinical Trail

Abstract Background: The current pandemic of the coronavirus disease-2019 (COVID-19) has badly affected our life during the year 2020. SARS-CoV-2 is the primary causative agent of the newly emerged pandemic. Natural flavonoids, Terpenoid and Thymoquinone are tested against different viral and host-cell protein targets. These natural compounds have a good history in treating Hepatitis C Virus (HCV) and Human Immunodeficiency Virus (HIV). Methods: Molecular docking combined with cytotoxicity and plaque reduction assay is used to test the natural compounds against different viral (Spike, RdRp, and Mpro) and host-cell (TMPRSS II, keap 1, and ACE2) targets. Results: The results demonstrate the binding possibility of the natural compounds (Thymol, Carvacrol, Hesperidine, and Thymoquinone) to the viral main protease (Mpro). Some of these natural compounds were approved to start clinical trail from Egypt Center for Research and Regenerative Medicine ECRRM IRB (Certificate No.IRB00012517)Conclusion: Development of an effective anti-viral for SARS-CoV-2 could help to limit the viral load. Benchmarking testing of those natural compounds against other potential antivirals for SARS-CoV-2 with alternative mechanisms of action would thus be important as soon as practicable.

Download Full-text

Interaction between the tobacco mosaic virus movement protein and host cell pectin methylesterases is required for viral cell-to-cell movement

The EMBO Journal ◽

10.1093/emboj/19.5.913 ◽

2000 ◽

Vol 19 (5) ◽

pp. 913-920 ◽

Cited By ~ 195

Author(s):

Min-Huei Chen ◽

Jinsong Sheng ◽

Geoffrey Hind ◽

Avtar K. Handa ◽

Vitaly Citovsky

Keyword(s):

Tobacco Mosaic Virus ◽

Host Cell ◽

Mosaic Virus ◽

Movement Protein ◽

Cell Movement ◽

Virus Movement

Download Full-text

First Report of Carrot red leaf virus and Carrot mottle virus, Causal Agents of Carrot Motley Dwarf, in Carrot in Mauritius

Plant Disease ◽

10.1094/pdis-93-11-1218b ◽

2009 ◽

Vol 93 (11) ◽

pp. 1218-1218 ◽

Cited By ~ 1

Author(s):

A. Gungoosingh-Bunwaree ◽

W. Menzel ◽

S. Winter ◽

V. Vally ◽

R. Seewoogoolam ◽

...

Keyword(s):

Rna Extraction ◽

Plant Viruses ◽

Biological Data ◽

Mottle Virus ◽

Economic Losses ◽

Degenerate Primers ◽

First Report ◽

Carrot Mottle Virus ◽

Leaf Virus ◽

Carrot Red Leaf Virus

Carrot motley dwarf (CMD) affects carrot and other apiaceous plants by causing leaf yellowing or reddening as well as plant stunting and leads often to serious economic losses wherever these crops are grown (2). CMD has been reported from Australia, Europe, Japan, Israel, and North America and is known to result from a mixed infection by at least two viruses, the polerovirus, Carrot red leaf virus (CtRLV), and one of the umbraviruses, Carrot mottle virus (CMoV) or Carrot mottle mimic virus (CMoMV). The viruses are transmitted in a circulative persistent manner by aphid species (Cavariella spp.). In November of 2008, symptoms typical of CMD were observed in carrot (Daucus carota) and coriander (Coriandrum sativum) plantations in the region of Henrietta in the central part of Mauritius. Carrot cultivars affected were Victoria, Sigma, and Namdhari. Incidences of up to 50% were recorded in some fields. Symptoms were observed mainly on plants near the edges of fields and were initially attributed to physiological factors. However, following RNA extraction from affected carrot plants and reverse transcription (RT)-PCR, fragments of the expected sizes (CtRLV; 377 bp: CMoV; 549 bp) were obtained. For CtRLV, a pair of degenerate primers (S2/AS3 [1]) for poleroviruses, and for the above mentioned umbraviruses, a universal primer pair (UmbraCS: CTTTGGAGTACACAACAACTCC and UmbraCAS: GCA/GTCIAGICCIACACAA/GACTGG, I = Inosin; unpublished) was used. Direct sequencing of one PCR product for each virus (Eurofins MWG Operon GmbH, Martinsried, Germany) and comparison with sequences retrieved from GenBank resulted in nucleotide and amino acid sequence identities of 93 and 90% (coat protein) to the CtRLV strain UK-1 (Accession No. AY695933) and 86 and 96% (replicase) to the German CMoV isolate (Accession No. FJ188473), respectively. Carrot samples also tested CtRLV-positive in triple-antibody sandwich-ELISA using polyclonal IgGs to CtRLV for trapping and a mixture of two CtRLV-specific monoclonal antibodies (CtRLV-2-3A9 and CtRLV 3-4B9) as detecting antibodies (all from the stock of the Julius Kuehn Institute; H. J. Vetten, Braunschweig, Germany). The presence of CMoV was confirmed by sap transmission to Nicotiana benthamiana and N. occidentalis ‘P1’, which resulted in vein yellowing/etching symptoms. In addition, agarose gel electrophoresis of the dsRNA extract of a primary infected carrot sample revealed major dsRNAs of approximately 4.2 and 1.4 kbp, which represent the genomic and subgenomic RNAs of an umbravirus. Thus, sequence analysis, as well as serological and biological data, demonstrates that CMD-affected carrot plants from Mauritius were infected with CtRLV and CMoV isolates closely related to those from Europe. The sequences obtained in this study for CtRLV and CMoV have been deposited in GenBank under Accession Nos. FJ969849 and FJ969848, respectively. To our knowledge, this is the first report of CMD in Mauritius and the Indian Ocean Region. Future works comprise an island wide survey across carrot-growing regions to determine the incidence of the virus complex and the natural host range of the viruses in Mauritius. References: (1) A. D. Abraham et al. Plant Dis. 91:1059, 2007. (2) A. F. Murant. No 137 in: Descriptions of Plant Viruses. Assoc. Appl. Biol. Kew, England, 1974.

Download Full-text