Response of cucumber cultivars to target spot based on epidemiological components of the disease monocycle

2021 ◽  
Author(s):  
Ivan Herman Fischer ◽  
Lucas Meleiro da Silva ◽  
Lilian Amorim ◽  
Juliana Altafin Galli ◽  
Marise Cagnin Martins Parisi
Keyword(s):  
2018 ◽  
Vol 19 (4) ◽  
pp. 303-309 ◽  
Author(s):  
Keevan J. MacKenzie ◽  
Leilani G. Sumabat ◽  
Katia V. Xavier ◽  
Gary E. Vallad

Corynespora cassiicola is a highly diverse fungal pathogen that can infect more than 500 species of plants, including many economically important crops such as cotton, soybean, tomato, and cucumber. In Florida, the number one vegetable crop by market value are fresh-market tomatoes, which generate nearly half a billion dollars annually. Florida’s subtropical to tropical climate is conducive to infection and development of the target spot pathogen on tomato caused by C. cassiicola. There is no varietal resistance available for target spot of tomato, and preventative fungicide treatments are the primary method for control. In the last decade, C. cassiicola has been more frequently reported by Florida tomato growers, appearing not only more aggressive but also increasingly insensitive to various fungicides. This review brings together the most recent C. cassiicola literature, providing a history and understanding of the immense pathogen diversity and its relevance to tomato. It also provides insight into fungicide resistance development and pathogen survivability, which are important factors in providing effective control recommendations and in understanding the epidemiology of this disease, respectively.


2012 ◽  
Vol 38 (No. 3) ◽  
pp. 81-88 ◽  
Author(s):  
K. Pernezny ◽  
P. Stoffella ◽  
J. Collins ◽  
A. Carroll ◽  
A. Beaney

Control of target spot of tomato, caused by the fungus Corynespora cassiicola (Berk. & Curt.) Wei., was studied in three seasons in southern Florida, USA. The strobilurin fungicide azoxystrobin and a combination product of mancozeb and fumoxate provided excellent control of target spot. In these treatments, accumulated disease severity values were only 10–15% of those in the untreated control and marketable yields were doubled. Excellent disease control also was achieved with acibenzolar-S-methyl, a systemic acquired resistance activator (SAR). This compound reduced defoliation of tomato plants by 42% compared to the control. An experimental compound, BAS 510 02, provided good control of target spot, reducing defoliation by 40% and increasing marketable yields by 34%. Harpin protein and Bacillis subtilis strain QST 713 were not effective for control of target spot.


Plant Disease ◽  
2020 ◽  
Vol 104 (3) ◽  
pp. 893-903 ◽  
Author(s):  
Keevan J. MacKenzie ◽  
Katia V. Xavier ◽  
Aimin Wen ◽  
Sujan Timilsina ◽  
Heather M. Adkison ◽  
...  

Target spot of tomato caused by Corynespora cassiicola is one of the most economically destructive diseases of tomato in Florida. A collection of 123 isolates from eight counties in Florida were evaluated for sensitivity to azoxystrobin and fenamidone based on mycelial growth inhibition (MGI), spore germination (SG), detached leaflet assays (DLAs), and sequence-based analysis of the cytochrome b gene (cytb). Cleavage of cytb by restriction enzyme (Fnu4HI) revealed the presence of a mutation conferring a glycine (G) to alanine (A) mutation at amino acid position 143 (G143A) in approximately 90% of the population, correlating with quinone outside inhibitor (QoI) resistance based on MGI (<40% at 5 μg/ml), SG (<50% at 1 and 10 μg/ml), and DLA (<10% severity reduction). The mutation conferring a phenylalanine (F) to leucine (L) substitution at position 129 (F129L) was confirmed in moderately resistant isolates (#9, #19, and #74) based on MGI (40 to 50% at 5 μg/ml), SG (<50% at 1 μg/ml and >50% at 10 μg/ml), and DLA (>10% and <43% severity reduction) for both QoI fungicides, whereas sensitive isolates (#1, #4, #7, #28, #29, #46, #61, #74, #75, #76, #91, #95, and #118) based on MGI (>50% at 5 μg/ml), SG (>50% at 1 μg/ml and 10 μg/ml), and DLA (>50% severity reduction) correlated to non-mutation-containing isolates or those with a silent mutation. This study indicates that QoI resistance among C. cassiicola isolates from tomato is widespread in Florida and validates rapid screening methods using MGI or molecular assays to identify resistant isolates in future studies.


2007 ◽  
Vol 1 (1) ◽  
pp. 170-175 ◽  
Author(s):  
Naohisa Hashimoto ◽  
Shin Kato ◽  
Naoko Minobe ◽  
Sadayuki Tsugawa
Keyword(s):  

Plant Disease ◽  
2012 ◽  
Vol 96 (3) ◽  
pp. 456-456 ◽  
Author(s):  
G. Mercado Cárdenas ◽  
M. Galván ◽  
V. Barrera ◽  
M. Carmona

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.


Author(s):  
Warlles Domingos Xavier ◽  
João Vitor de Souza Silva ◽  
Claudinei Martins Guimarães ◽  
Jorge Luís Sousa Ferreira ◽  
Thiago Albuquerque Turozi ◽  
...  

At level word fungal diseases that affect soybean crop are one of the main causes of low productivity and annual losses may reach 21% of total production. In this context, the objective of the study was to evaluate the efficiency of copper-based protectors associated with fungicides to control soybean diseases such as: asian soybean rust (Phakopsora pachyrhizi), target spot of soybean (Corynespora cassiicola) and cercospora leaf blight (Cercospora kikuchii) + frogeye leaf spot (Cercospora sojina) + brown spot (Septoria glycines), which together were considered as late-crop cycle diseases, with impact on grain yield, in the region of Aparecida do Rio Negro – TO, Brazil. Treatments were composed of different rates of copper-based pesticides associated with fungicides like Azimut® (first application), Orkestra® (second application), Ativum® (third application) and Horos® (fourth application) in soybean. Diseases were identified and crop damage evaluations on leaves were performed using LI-COR® portable meter 7 days after the fourth application. At physiological maturity, grain yield was evaluated. Combined rates of fungicides + Unizeb Gold® (1.5 kg ha-1), Difere® (0.5 L ha-1), and NHT® Copper Super at a rate higher than 0.109 L ha-1, were effective to control late crop-cycle diseases in soybean. Associated applications of fungicides + 0.219 L/ha of NHT® Copper Super reduced the severity of Asian soybean rust, target spot of soybean and late crop-cycle diseases with a greater increase in grain yield (4.5 Mg ha-1).


2005 ◽  
pp. 175-180
Author(s):  
K. Pernezny ◽  
P. Stoffella ◽  
N. Havranek ◽  
J. Sanchez ◽  
A. Beany
Keyword(s):  

Plant Disease ◽  
1995 ◽  
Vol 79 (1) ◽  
pp. 5 ◽  
Author(s):  
H. D. Shew
Keyword(s):  

Sign in / Sign up

Export Citation Format

Share Document