wblA , a pleiotropic regulatory gene modulating morphogenesis and daptomycin production in Streptomyces roseosporus

2017 ◽  
Vol 123 (3) ◽  
pp. 669-677 ◽  
Author(s):  
X. Huang ◽  
T. Ma ◽  
J. Tian ◽  
L. Shen ◽  
H. Zuo ◽  
...  
Keyword(s):  
Regulatory Gene ◽  
Streptomyces Roseosporus ◽  
Daptomycin Production

scholarly journals DepR1, a TetR Family Transcriptional Regulator, Positively Regulates Daptomycin Production in an Industrial Producer, Streptomyces roseosporus SW0702

2016 ◽  
Vol 82 (6) ◽  
pp. 1898-1905 ◽  
Author(s):  
Peng-Hui Yuan ◽  
Ri-Cheng Zhou ◽  
Xuepeng Chen ◽  
Shuai Luo ◽  
Feng Wang ◽  
...  
Keyword(s):  
Genetic Engineering ◽  
Direct Interaction ◽  
Morphological Differentiation ◽  
Transcriptional Regulator ◽  
Mobility Shift ◽  
Positive Role ◽  
Content Type ◽  
Positive Effects ◽  
Streptomyces Roseosporus ◽  
Daptomycin Production

ABSTRACTDaptomycin is a potent cyclic lipopeptide antibiotic. It is widely used against various Gram-positive bacterial pathogens. Historically, a poor understanding of the transcriptional regulation of daptomycin biosynthesis has limited the options for targeted genetic engineering toward titer improvement. Here, we isolated a TetR family transcriptional regulator, DepR1, from the industrial producerStreptomyces roseosporusSW0702 using a biotinylateddptEpromoter (dptEp) as a probe. The direct interaction between DepR1 anddptEpthen was confirmed by electrophoretic mobility shift assays and DNase I footprinting assays. The deletion ofdepR1led to a reduction indptEpactivity and the cessation of daptomycin production. TheΔdepR1mutant produced less red pigment and failed to sporulate on R5 medium. This suggests that DepR1 plays a positive role in the control of morphological differentiation. Moreover, DepR1 was positively autoregulated by directly binding to its own promoter. This might account for the positive feedback regulation of daptomycin production. Based on these positive effects, genetic engineering by overexpression ofdepR1raised daptomycin production and shortened the fermentation period both in flask and in fermentor.

Genome Shuffling of Streptomyces roseosporus for Improving Daptomycin Production

2014 ◽  
Vol 172 (5) ◽  
pp. 2661-2669 ◽  
Author(s):  
Guanghai Yu ◽  
Yuansen Hu ◽  
Ming Hui ◽  
Liang Chen ◽  
Le Wang ◽  
...  
Keyword(s):  
Genome Shuffling ◽  
Streptomyces Roseosporus ◽  
Daptomycin Production

scholarly journals A MarR Family Transcriptional Regulator, DptR3, Activates Daptomycin Biosynthesis and Morphological Differentiation in Streptomyces roseosporus

2015 ◽  
Vol 81 (11) ◽  
pp. 3753-3765 ◽  
Author(s):  
Qinling Zhang ◽  
Qiong Chen ◽  
Shuai Zhuang ◽  
Zhi Chen ◽  
Ying Wen ◽  
...  
Keyword(s):  
Pathogenic Bacteria ◽  
Protein A ◽  
Morphological Differentiation ◽  
Transcriptional Regulator ◽  
Aerial Mycelium ◽  
Morphological Development ◽  
Content Type ◽  
Streptomyces Roseosporus ◽  
Solid Media ◽  
Daptomycin Production

ABSTRACTDaptomycin produced byStreptomyces roseosporusis an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized thedptR3gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion ofdptR3reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription ofdptstructural genes. DptR3 directly activated the transcription of its own gene,dptR3, but repressed the transcription of the adjacent, divergent geneorf16(which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region ofdptR3-orf16was determined by DNase I footprinting, and the palindromic sequenceTCATTGTTACCTATGCTCACAATGA(underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding.orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development inS. roseosporus.

Strain Improvement Program of Streptomyces roseosporus for Daptomycin Production

2021 ◽  
pp. 351-363
Author(s):  
Sara Rubio ◽  
Sonia Martínez-Cámara ◽  
Juan Luis de la Fuente ◽  
Marta Rodríguez-Sáiz ◽  
José-Luis Barredo
Keyword(s):  
Strain Improvement ◽  
Improvement Program ◽  
Streptomyces Roseosporus ◽  
Daptomycin Production

DptR2, a DeoR-type auto-regulator, is required for daptomycin production in Streptomyces roseosporus

Gene ◽  
2014 ◽  
Vol 544 (2) ◽  
pp. 208-215 ◽  
Author(s):  
Feng Wang ◽  
Ni-Ni Ren ◽  
Shuai Luo ◽  
Xiao-Xia Chen ◽  
Xu-Ming Mao ◽  
...  
Keyword(s):  
Streptomyces Roseosporus ◽  
Daptomycin Production

Improvement of daptomycin production via increased resistance to decanoic acid in Streptomyces roseosporus

2016 ◽  
Vol 122 (4) ◽  
pp. 427-433 ◽  
Author(s):  
Sung-Kwon Lee ◽  
Hong Rip Kim ◽  
Ying-Yu Jin ◽  
Seung Hwan Yang ◽  
Joo-Won Suh
Keyword(s):  
Decanoic Acid ◽  
Streptomyces Roseosporus ◽  
Daptomycin Production
Sign in / Sign up

Export Citation Format

Share Document