scholarly journals PM 7/064 (2) Xanthomonas arboricola pv. pruni

EPPO Bulletin ◽  
2021 ◽  
Vol 51 (2) ◽  
pp. 240-266
Keyword(s):  
Xanthomonas Arboricola

scholarly journals Comparative Genomics of Xanthomonaseuroxanthea and Xanthomonas arboricola pv. juglandis Strains Isolated from a Single Walnut Host Tree

2021 ◽  
Vol 9 (3) ◽  
pp. 624
Author(s):  
Camila Fernandes ◽  
Leonor Martins ◽  
Miguel Teixeira ◽  
Jochen Blom ◽  
Joël F. Pothier ◽  
...  
Keyword(s):  
Extracellular Enzymes ◽  
Walnut Tree ◽  
Size Number ◽  
A Genome ◽  
Type 3 Secretion System ◽  
Xanthomonas Arboricola ◽  
Chromosomal Sequences ◽  
Related Proteins ◽  
Type 3 ◽  
Genome Comparisons

The recent report of distinct Xanthomonas lineages of Xanthomonas arboricola pv. juglandis and Xanthomonas euroxanthea within the same walnut tree revealed that this consortium of walnut-associated Xanthomonas includes both pathogenic and nonpathogenic strains. As the implications of this co-colonization are still poorly understood, in order to unveil niche-specific adaptations, the genomes of three X. euroxanthea strains (CPBF 367, CPBF 424T, and CPBF 426) and of an X. arboricola pv. juglandis strain (CPBF 427) isolated from a single walnut tree in Loures (Portugal) were sequenced with two different technologies, Illumina and Nanopore, to provide consistent single scaffold chromosomal sequences. General genomic features showed that CPBF 427 has a genome similar to other X. arboricola pv. juglandis strains, regarding its size, number, and content of CDSs, while X. euroxanthea strains show a reduction regarding these features comparatively to X. arboricola pv. juglandis strains. Whole genome comparisons revealed remarkable genomic differences between X. arboricola pv. juglandis and X. euroxanthea strains, which translates into different pathogenicity and virulence features, namely regarding type 3 secretion system and its effectors and other secretory systems, chemotaxis-related proteins, and extracellular enzymes. Altogether, the distinct genomic repertoire of X. euroxanthea may be particularly useful to address pathogenicity emergence and evolution in walnut-associated Xanthomonas.

scholarly journals Assessment of Xanthomonas arboricola pv. juglandis Bacterial Load in Infected Walnut Fruits by Quantitative PCR

Plant Disease ◽  
2019 ◽  
Vol 103 (10) ◽  
pp. 2577-2586
Author(s):  
Leonor Martins ◽  
Camila Fernandes ◽  
Pedro Albuquerque ◽  
Fernando Tavares
Keyword(s):  
Quantitative Pcr ◽  
Juglans Regia ◽  
Bacterial Load ◽  
Etiologic Agent ◽  
Economic Losses ◽  
Rapid Diagnostics ◽  
In Planta ◽  
Chromosomal Dna ◽  
Fruit Samples ◽  
Xanthomonas Arboricola

Xanthomonas arboricola pv. juglandis is the etiologic agent of important walnut (Juglans regia L.) diseases, causing severe fruit drop and high economic losses in walnut production regions. Rapid diagnostics and knowledge of bacterial virulence fitness are key to hinder disease progression and apply timely phytosanitary measures. This work describes an X. arboricola pv. juglandis-specific real-time quantitative PCR (qPCR) using X. arboricola pv. juglandis-specific DNA markers to quantify the bacterial load in infected walnut plant tissues. Method validation was achieved using calibration curves obtained with serial dilutions of X. arboricola pv. juglandis chromosomal DNA and standard curves obtained from walnut samples spiked with X. arboricola pv. juglandis cells. High correlations (R2 > 0.990 and > 0.995) and low limits of detection (35 chromosomes/qPCR reaction and 2.7 CFU/qPCR reaction) were obtained for both markers considering the calibration and standard curves, respectively. Assessment of qPCR repeatability, reproducibility, and specificity allowed us to demonstrate the reliability and consistency of the method. Furthermore, in planta quantification of X. arboricola pv. juglandis bacterial load using infected walnut fruit samples showed a higher detection resolution compared with standard PCR detection. By allowing quantification of virulence fitness of distinct X. arboricola pv. juglandis strains in planta, the proposed qPCR method may contribute to assertive risk assessment of walnut diseases caused by X. arboricola pv. juglandis and ultimately help to improve phytosanitary practices.

scholarly journals Lateral flow immunoassay for on-site detection of Xanthomonas arboricola pv. pruni in symptomatic field samples

PLoS ONE ◽  
2017 ◽  
Vol 12 (4) ◽  
pp. e0176201 ◽  
Author(s):  
Pablo López-Soriano ◽  
Patricia Noguera ◽  
María Teresa Gorris ◽  
Rosa Puchades ◽  
Ángel Maquieira ◽  
...  
Keyword(s):  
Lateral Flow ◽  
Lateral Flow Immunoassay ◽  
Field Samples ◽  
Xanthomonas Arboricola

scholarly journals Development of a Bio-PCR Protocol for the Detection of Xanthomonas arboricola pv. pruni

Plant Disease ◽  
2011 ◽  
Vol 95 (9) ◽  
pp. 1109-1115 ◽  
Author(s):  
E. L. Ballard ◽  
R. G. Dietzgen ◽  
L. I. Sly ◽  
C. Gouk ◽  
C. Horlock ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Field Evaluation ◽  
Subtractive Hybridization ◽  
Epiphytic Bacteria ◽  
Supportive Evidence ◽  
Chain Reaction ◽  
Dna Library ◽  
Xanthomonas Arboricola ◽  
Polymerase Chain

A real-time SYBR Green I assay was developed and evaluated as a biological and enzymatic polymerase chain reaction (Bio-PCR) protocol for the detection of Xanthomonas arboricola pv. pruni. Suppression subtractive hybridization was used to generate a X. arboricola pv. pruni-specific subtracted DNA library, using X. arboricola pv. corylina as the driver strain. Primer pair 29F/R, designed from cloned sequence, showed no homology to GenBank sequences and amplified a 344-bp product in all X. arboricola pv. pruni isolates. Compared with other published X. arboricola pv. pruni primers, this primer pair was shown to be the only one capable of differentiating X. arboricola pv. pruni from all other X. arboricola pathovars. A real-time assay was developed and shown to be capable of detecting less than 10 CFU and 0.1 pg of DNA. Epiphytic bacteria isolated from plum tissue was used to further evaluate the specificity of the assay. A Bio-PCR protocol, developed for field evaluation, confirmed X. arboricola pv. pruni isolation from asymptomatic and symptomatic plum tissue over a 9-week period between host flowering and the first appearance of leaf and fruit symptoms in an orchard. Dilution plating enabled X. arboricola pv. pruni numbers to be quantified, providing supportive evidence for the usefulness of the Bio-PCR protocol in plant pathology and quarantine surveillance.

Multilocus Sequence Analysis and Copper Ion Resistance Detection of 60 Xanthomonas arboricola pv. juglandis Isolates from China

Plant Disease ◽  
2021 ◽  
Author(s):  
Benzhong Fu ◽  
Jieqian Zhu ◽  
Conard Lee ◽  
Lihua Wang
Keyword(s):  
Sequence Analysis ◽  
Copper Ion ◽  
Housekeeping Genes ◽  
Threshold Value ◽  
Pcr Primers ◽  
Multilocus Sequence Analysis ◽  
Nucleotide Polymorphisms ◽  
Specific Pcr ◽  
Resistant Strains ◽  
Xanthomonas Arboricola

Walnut bacterial blight caused by Xanthomonas arboricola pv. juglandis (Xaj) has serious repercussions for walnut production around the world. Between 2015 and 2017, disease samples were collected from six counties (Danjiangkou, Baokang, Suizhou, Shennongjia, Zigui, and Xingshan) in Hubei province, China. Fifty-nine Xaj strains were identified by morphology and specific PCR primers from 206 isolates. The genetic diversity of 60 Xaj strains (59 from Hubei plus one from Beijing) was evaluated by Multilocus Sequence Analysis (MLST), and their resistance to copper ion (Cu2+) treatment was determined. A Neighbor Joining phylogenetic dendrogram was constructed based on four sequences of housekeeping genes (atpD-dnaK-glnA-gyrB). Two groups of strains were identified whose clustering was consistent with that of glnA. The minimal inhibitory concentration of copper ion on representative Xaj strain DW3F3 (the first genome sequenced Xaj from China) was 115 μg/ml. Setting the copper resistant threshold value to 125 μg/ml, 47 and 13 strains were considered sensitive and resistant to Cu2+, respectively. Furthermore, five strains showed Cu2+ resistance at 270 μg/ml. Compared to the copB from sensitive strains, the copB gene in resistant strains had a 15-bp insertion and eight scattered single nucleotide polymorphisms. Interestingly, the clustering based on MLSA was distinct between Xaj copper ion resistant and sensitive strains.

scholarly journals Heritability of peach tree resistance to bacterial leaf spot

2017 ◽  
Vol 52 (5) ◽  
pp. 366-369 ◽  
Author(s):  
André Luiz Varago ◽  
Idemir Citadin ◽  
Marcos Robson Sachet ◽  
Gener Augusto Penso ◽  
Maria do Carmo Bassols Raseira
Keyword(s):  
Leaf Area ◽  
Disease Severity ◽  
Leaf Spot ◽  
Field Conditions ◽  
Broad Sense Heritability ◽  
Peach Tree ◽  
Bacterial Leaf Spot ◽  
Tree Resistance ◽  
Leaf Area Duration ◽  
Xanthomonas Arboricola

Abstract: The objective of this work was to evaluate the broad-sense heritability reaction to bacterial leaf spot (Xanthomonas arboricola pv. pruni), in peach tree populations obtained from directed crosses. Disease severity and defoliation of the genotypes were evaluated in field conditions, with posterior measurement of the healthy leaf area duration (HAD). The observed average heritability (0.51) indicates that the use of the evaluated genitors can be effective for the development of cultivars with higher resistance to the disease.

scholarly journals Genome Sequence of Xanthomonas arboricola pv. Corylina, Isolated from Turkish Filbert in Colorado

2013 ◽  
Vol 1 (3) ◽  
Author(s):  
J. Ibarra Caballero ◽  
M. M. Zerillo ◽  
J. Snelling ◽  
C. Boucher ◽  
N. Tisserat
Keyword(s):  
Genome Sequence ◽  
Xanthomonas Arboricola

scholarly journals Desenvolvimento e fitossanidade de ameixeiras tratadas com silício em sistema orgânico

2013 ◽  
Vol 35 (4) ◽  
pp. 1059-1065 ◽  
Author(s):  
Silvana Girotto Martins Ferreira ◽  
Renato Vasconcelos Botelho ◽  
Cacilda Márcia Duarte Rios Faria ◽  
Milena Aparecida Ferrari Mateus ◽  
Welton Luiz Zaluski
Keyword(s):  
Myzus Persicae ◽  
Grapholita Molesta ◽  
Xanthomonas Arboricola

O objetivo deste trabalho foi avaliar o efeito do silício (Si) aplicado via pulverização foliar em ameixeiras cv. Pluma 7, para o controle da bacteriose (Xanthomonas arborícola pv. pruni), mariposa oriental (Grapholita molesta) e pulgão-verde (Myzus persicae), bem como no desenvolvimento das plantas, em sistema orgânico de produção. Para o ensaio, foi utilizado o produto comercial AgriSil® (98% de SiO2). O experimento foi conduzido em Guarapuava-PR, durante dois ciclos consecutivos (2010/2011 e 2011/2012). As doses utilizadas foram: 0; 1; 2;4 e 8 g L-1 do produto comercial, aplicadas quinzenalmente. Nos dois ciclos de avaliação, foram observadas reduções de até 85% na incidência da bacteriose com efeito quadrático das doses de silício. Os danos causados pela mariposa oriental, o número de pulgões, o diâmetro e o comprimento de ramos das plantas de ameixeira não foram significativamente influenciados pelas aplicações de SiO2. Quanto ao teor de Si foliar, observou-se efeito linear positivo em função das doses de Si.

scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

Sign in / Sign up

Export Citation Format

Share Document