An Improved In Silico Algorithm for Output Visualization of DNA Computing Based on Real-Time PCR

2008 ◽  
Author(s):  
Muhammad Faiz Mohamed Saaid ◽  
Zuwairie Ibrahim ◽  
Nor Haniza Sarmin
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
In Silico ◽  
Dna Computing ◽  
In Silico Algorithm

scholarly journals Efficient nested-PCR-based method development for detection and genotype identification of Acanthamoeba from a small volume of aquatic environmental sample

2021 ◽  
Vol 11 (1) ◽  
Author(s):  
Tsui-Kang Hsu ◽  
Jung-Sheng Chen ◽  
Hsin-Chi Tsai ◽  
Chi-Wei Tao ◽  
Yu-Yin Yang ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Nested Pcr ◽  
In Silico ◽  
Environmental Samples ◽  
Method Development ◽  
Small Volume ◽  
Detection Efficiency ◽  
Genotyping Method ◽  
Pcr Method

AbstractAcanthamoeba spp. are opportunistic human pathogens that cause granulomatous amoebic encephalitis and keratitis, and their accurate detection and enumeration in environmental samples is a challenge. In addition, information regarding the genotyping of Acanthamoeba spp. using various PCR methods is equally critical. Therefore, considering the diverse niches of habitats, it is necessary to develop an even more efficient genotyping method for Acanthamoeba spp. detection. This study improved the sensitivity of detection to avoid underestimation of Acanthamoeba spp. occurrence in aquatic environmental samples, and to accurately define the pathogenic risk by developing an efficient PCR method. In this study, a new nested genotyping method was established and compared with various PCR-based methods using in silico, lab, and empirical tests. The in silico test showed that many PCR-based methods could not successfully align specific genotypes of Acanthamoeba, except for the newly designed nested PCR and real-time PCR method. Furthermore, 52 water samples from rivers, reservoirs, and a river basin in Taiwan were analysed by six different PCR methods and compared for genotyping and detection efficiency of Acanthamoeba. The newly developed nested-PCR-based method of genotyping was found to be significantly sensitive as it could effectively detect the occurrence of Acanthamoeba spp., which was underestimated by the JDP-PCR method. Additionally, the present results are consistent with previous studies indicating that the high prevalence of Acanthamoeba in the aquatic environment of Taiwan is attributed to the commonly found T4 genotype. Ultimately, we report the development of a small volume procedure, which is a combination of recent genotyping PCR and conventional real-time PCR for enumeration of aquatic Acanthamoeba and acquirement of biologically meaningful genotyping information. We anticipate that the newly developed detection method will contribute to the precise estimation, evaluation, and reduction of the contamination risk of pathogenic Acanthamoeba spp., which is regularly found in the water resources utilised for domestic purposes.

scholarly journals A Real-time Quantitative Polymerase Chain Reaction for the Specific Detection of Hammondia Hammondi and Its Differentiation from Toxoplasma Gondii

2020 ◽  
Author(s):  
Gereon Schares ◽  
Majda Globokar Vrhovec ◽  
Mareen Tuschy ◽  
Maike Joeres ◽  
Andrea Bärwald ◽  
...  
Keyword(s):  
Toxoplasma Gondii ◽  
Real Time ◽  
Real Time Pcr ◽  
Post Infection ◽  
In Silico ◽  
Repetitive Element ◽  
Sequence Data ◽  
Quantitative Polymerase Chain Reaction ◽  
Analytical Sensitivity ◽  
Biological Studies

Abstract Introduction: Hammondia hammondi and Toxoplasma gondii are closely related protozoan parasites, but only T. gondii is zoonotic . Both species use felids as definitive hosts and cannot be differentiated by oocyst morphology. In T. gondii, a 529 bp repetitive element (TgREP-529) is of utmost diagnostic importance for PCR diagnostic tests. We identified a similar repetitive region in the H. hammondi genome (HhamREP-529).Material and Methods: Based on reported sequences, primers and probes were selected in silico and optimal primer probe combinations were explored, also by including previously published primers. The analytical sensitivity was tested using serial dilutions of oocyst DNA. For testing analytical specificity, DNA isolated from several related species were used as controls. The newly established TaqMan PCR (Hham-qPCR1) was applied to tissues collected from H. hammondi-infected gamma-interferon knockout (GKO) mice at varying time points post infection. Results: Ten forward and six reverse primers were tested in varying combinations. Four potentially suitable dual-labelled probes were selected. One set based on the primer pair (Hham275F, Hham81R) and the probe (Hham222P) yielded optimal results. In addition to excellent analytic specificity, the assay revealed an analytical sensitivity of genome equivalents of less than 1 oocyst. Investigation of the tissue distribution in GKO mice revealed the presence of parasite DNA in all examined organs, but to a varying extent suggesting 100- to 10.000-fold differences in parasitic loads between tissues in the chronic state of infection, 42 days post infection. Discussion: The use of the 529 bp repeat of H. hammondi is suitable for establishing a quantitative real-time PCR assay because this repeat probably exists about 200-times in the genome of a single organism, like its counterpart in T. gondii. Although there was enough sequence data available, only few of the primers predicted in silico revealed sufficient amplification; the identification of a suitable probe was also difficult. This is in accord with our previous observations on considerable variability in the 529 bp repetitive element of H. hammondi.Conclusions: The H. hammondi real-time PCR represents an important novel diagnostic tool for epidemiological and cell-biological studies on this and related parasites.

scholarly journals Cardiac miRNAs were involved in the regulation of pathophysiological mechanisms underlying HF in pediatric patients after ventricular assist device implantation

2021 ◽  
Vol 42 (Supplement_1) ◽  
Author(s):  
R Ragusa ◽  
A Di Molfetta ◽  
S Del Turco ◽  
G Basta ◽  
M Rizzo ◽  
...  
Keyword(s):  
Cardiac Muscle ◽  
Real Time ◽  
Mirna Expression ◽  
Real Time Pcr ◽  
In Silico ◽  
In Silico Analysis ◽  
Adiponectin Receptors ◽  
Silico Analysis

Abstract Background VAD use in heart failure (HF) children have undergone rapid progress in the last three decades through pump technological innovation and improvement of perioperative care. Studies in HF adults showed that VAD put native heart at rest and lead to molecular changes in cardiac muscle, including at microRNA (miRNA) level. However, little is known on changes induced by VAD implant in cardiac miRNA expression and their putative targets in HF children. Purpose The aims of this study were to evaluate: 1) modification of miRNA expression in cardiac muscle from HF children after VAD support; 2) the putative targets of selected miRNAs by in silico analysis; 2) the role of the identify miRNAs on putative targets by in vitro study. Methods Cardiac biopsies were collected from HF children at the moment of VAD implant [n=8; 20 (7.5–64.5) months, 2 males; 19 (15.75–32.25) LVEF%] and at the time of heart transplant after VAD support [n=5; 32 (5–204) months; 4 males; 13.5 (10–18) LVEF%]. Cardiac miRNA expression was evaluated by NGS. The potential miRNA targets were identified by bioinformatics analyses and their cardiac expression by real-time PCR was evaluated. HL-1 cell line was used for testing the regulatory role of selected miRNA on predicted targets by miRNA mimic transfection study. Results At NGS, 465 miRNA were found on average in each sample and the cardiac expression levels of miR19a-3p, miR-1246 and miR-199b-5p decreased in HF children after VAD support compared to pre-implant (Fig. 1A-B). In silico analysis showed that more than 5000 potential gene targets regulated by miR-19a-3p, miR-1246 and miR-199b-5p. Among them, adiponectin receptors (AdipoR1, AdipoR2, T-CAD) were identified as common targets for 3 miRNAs. Real-time PCR data showed that levels of all adiponectin receptors increased significantly whilst the expression of 3 miRNAs decreased after VAD support (Fig. 1C). Moreover, AdipoR2 and T-CAD were inversely related to miRNA levels (Fig. 1D). In vitro studies confirmed the regulatory role of miR-1246 and miR-199b-5p on AdipoR2 (Fig. 1E-F), whilst only miR-199b-5p reduced the expression of T-CAD (Fig. 1G). Finally, AdipoR1 expression levels are not modified compared to control by miRNAs mimic transfection (data not shown). Conclusion In HF children the use of VAD could modify the expression of several miRNAs potentially involved in the regulation of several pathophysiological mechanisms underlying HF. Specifically, the reductions of miR-1246, mir-19a-3p, miR-199b-5p were associated with an increase of the adiponectin receptors AdipoR2 and T-CAD mRNA, suggesting the existence of a miRNAs related fine tuning of the adiponectin system at cardiac tissue level by VAD implant, able to favour the protective effect of adiponectin in HF cardiac muscle. FUNDunding Acknowledgement Type of funding sources: Public grant(s) – EU funding. Main funding source(s): FP7-ICT-2009 Project, Grant Agreement 24863 Figure 1

Desain Primer dan Analisis in Silico untuk Amplifikasi Gen mt-Co1 pada Tikus got (Rattus norvegicus)

2021 ◽  
Vol 1 (2) ◽  
pp. 20-29
Author(s):  
Maria A E D Sihotang ◽  
Yola Eka Erwinda ◽  
Eniek Suwarni ◽  
Erita Lusianti
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Rattus Norvegicus ◽  
In Silico ◽  
Taqman Probe ◽  
Chain Reaction ◽  
Polymerase Chain

Daging tikus got (Rattus norvegicus) merupakan salah satu bahan yang kadang-kadang digunakan untuk campuran bakso sapi dan pangan olahan lain untuk menekan harga produksi. Hal ini sangat merugikan konsumen, baik dari segi kesehatan maupun kehalalan produk pangan. Untuk mencegah terjadinya hal tersebut, pengembangan metode uji untuk mendeteksi daging tikus got dalam pangan olahan sangat diperlukan. Salah satu metode yang mudah dan cepat dalam mengidentifikasi daging tikus got dalam pangan olahan adalah metode Polymerase Chain Reaction (PCR). Pengembangan metode endpoint PCR telah dilakukan, namun metode tersebut masih memiliki beberapa kekurangan dari segi spesifisitas dan kecepatan dalam perolehan hasil. pengembangan metode deteksi daging tikus got dengan metode real-time PCR perlu dikombinasikan dengan TaqMan probe yang lebih sensitif dan spesifik, sehingga dapat menjadi alternatif untuk pendeteksian daging tikus got dalam pangan olahan. Desain primer dan probe merupakan langkah awal dalam pengembangan metode deteksi dengan real-time PCR.  Penelitian ini bertujuan mendesain primer dan probe untuk deteksi gen mt-Co1 pada tikus got lalu dianalisis in silico. Sekuens gen mt-Co1 Rattus norvegicus (NC_001665.2) diperoleh dari pangkalan data National Center of Biotechnology Information (NCBI). Primer didesain menggunakan perangkat lunak Primer3Plus. Selanjutnya, beberapa kandidat primer dan probe dianalisis spesifisitasnya terhadap gen mt-CoI secara in silico menggunakan beberapa perangkat lunak, antara lain Primer-BLAST dan Nucleotide-BLAST. Primer dan probe yang spesifik terhadap gen mt-CoI pada tikus got (Rattus norvegicus) berhasil dikonstruksi dengan sekuens primer forward ATGAGCAAAAGCCCACTTTG; sekuen primer reverse CGGCCGTAAGTGAGATGAAT; dan probe GCAGGGATACCTCGTCGTTA. Primer dan probe ini dapat dimanfaatkan untuk pengembangan metode deteksi daging tikus pada bakso atau pangan olahan lain menggunakan real-time PCR dan TaqMan probe.

scholarly journals In Silico Analysis of Actin Gene as a Candidate for DNA Non-Halal Detection Base on Real-Time PCR

2021 ◽  
Vol 3 (2) ◽  
pp. 70-74
Author(s):  
Seagames Waluyo ◽  
Jekmal Malau ◽  
Muhareva Raekiansyah ◽  
Edwin Yulian ◽  
Imam Hardiman
Keyword(s):  
Real Time ◽  
Internal Control ◽  
Real Time Pcr ◽  
In Silico ◽  
Melting Curve ◽  
In Silico Analysis ◽  
Family Type ◽  
Actin Gene ◽  
Degenerate Primers ◽  
Actin Genes

Actin genes are genes that are common in organisms, and their expression is constitutive. These genes are used for gene normalization and internal control of DNA extraction, but the actin gene is not widely used for halal certification tests. Bioinformatic studies help to analyze the experiment through in silico more deeply before the experiment is carried out in laboratory, making it more efficient and time effective. uMelt is an analysis to predict the melting curve of target amplification in real-time PCR. Real-time PCR has been widely used for screening and detection of pork content in a product. This research aimed to explore actin gene as a candidate for testing pork using qPCR. The study was carried out in two main stages, namely alignment of the DNA sequence and analysis of the melting curve using the uMelt approach. The results showed a set of actin genes containing conserved regions that can be used as degenerate primers with different family-type coverages. Melting curve prediction with uMelt shows differences in tm peaks so as the types of samples can be easily identified. The use of bioinformatic applications such as uMelt helps in the simulation of predicting the melting curve to increase the precision of the analysis.

scholarly journals A real-time quantitative polymerase chain reaction for the specific detection of Hammondia hammondi and its differentiation from Toxoplasma gondii

2021 ◽  
Vol 14 (1) ◽  
Author(s):  
Gereon Schares ◽  
Majda Globokar Vrhovec ◽  
Mareen Tuschy ◽  
Maike Joeres ◽  
Andrea Bärwald ◽  
...  
Keyword(s):  
Polymerase Chain Reaction ◽  
Toxoplasma Gondii ◽  
Real Time ◽  
Real Time Pcr ◽  
Post Infection ◽  
In Silico ◽  
Repetitive Element ◽  
Analytical Sensitivity ◽  
Chain Reaction ◽  
Polymerase Chain

Abstract Introduction Hammondia hammondi and Toxoplasma gondii are closely related protozoan parasites, but only T. gondii is zoonotic. Both species use felids as definitive hosts and cannot be differentiated by oocyst morphology. In T. gondii, a 529-base pair (bp) repetitive element (TgREP-529) is of utmost diagnostic importance for polymerase chain reaction (PCR) diagnostic tests. We identified a similar repetitive region in the H. hammondi genome (HhamREP-529). Methods Based on reported sequences, primers and probes were selected in silico and optimal primer probe combinations were explored, also by including previously published primers. The analytical sensitivity was tested using serial dilutions of oocyst DNA. For testing analytical specificity, DNA isolated from several related species was used as controls. The newly established TaqMan PCR (Hham-qPCR1) was applied to tissues collected from H. hammondi-infected gamma-interferon gene knockout (GKO) mice at varying time points post-infection. Results Ten forward and six reverse primers were tested in varying combinations. Four potentially suitable dual-labelled probes were selected. One set based on the primer pair (Hham275F, Hham81R) and the probe (Hham222P) yielded optimal results. In addition to excellent analytic specificity, the assay revealed an analytical sensitivity of genome equivalents of less than one oocyst. Investigation of the tissue distribution in GKO mice revealed the presence of parasite DNA in all examined organs, but to a varying extent, suggesting 100- to 10,000-fold differences in parasitic loads between tissues in the chronic state of infection, 42 days post-infection. Discussion The use of the 529-bp repeat of H. hammondi is suitable for establishing a quantitative real-time PCR assay, because this repeat probably exists about 200 times in the genome of a single organism, like its counterpart in T. gondii. Although there were enough sequence data available, only a few of the primers predicted in silico revealed sufficient amplification; the identification of a suitable probe was also difficult. This is in accord with our previous observations on considerable variability in the 529-bp repetitive element of H. hammondi. Conclusions The H. hammondi real-time PCR represents an important novel diagnostic tool for epidemiological and cell biological studies on H. hammondi and related parasites.

Sign in / Sign up

Export Citation Format

Share Document